SimpleSearch - Line and FST details


Line specific information

 
Line ID 099C03
Vector Used pAC161
Line Availability only available from NASC (N409435)
Segregation Analysis 100:98:83
Confirmed for Hit At1g50370
Parent of DUPLO pair none
Parent of pair(s) 4719, 4732, 7385, 10082, 83716, 83727, 83768, 83777, 83778, 83779, 83780, 83781, 83782

Gene hit At1g50370

 
Sequence (A. th genome BLAST matches underlined)
>19-012074-strizhov-C3-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATACTGACACT
GCTTGCCTCCGTCTTCATCCATTCTCTGTGGACTAGTCAGCATACAGTCCGTATTCGGAC
TGATCGTGCCACTCACTATTCTGACCAGCCTCACAAGAGTAAGCGACTATGGGGGGCTTT
GTATAGGCATGACTGTTCCGAGAACAGAAAGCACGCTAGAGAAGATAGAGGAATGATGAT
TATGGCGTACGTATTCGCAGAGAAGTTGAAGCTCGTCCTCAGAGAGATGTTGGCCGTCTT
TAACCTTGGAAATCCCTTGATCTAAATCCATGGCGGCCTTTTATTATCCTCTCTGTCTCT
CTCTTTCGGTGGTGAAGTGGAAATTGGTGCTGTTTCTTCGATTTCAATGGTGAGTCTCGA
CGATCTCTGGTGAAGAATTGAAAGAAAGATAGATCTATGGGATCCTCCCTATAGTGAGTC
GATTTACT
GenBank Accession BX546531 [GenBank]
Graphic View Graphic view of gene At1g50370
Predicted Position of Insertion Chr1:18659166 - go to primer design
BLAST e Value 3e-116
Hit Clone Code (BAC ID) F14I3
Hit Gene Code At1g50370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23