SimpleSearch - Line and FST details


Line specific information

 
Line ID 099E03
Vector Used pAC161
Line Availability only available from NASC (N409459)
Segregation Analysis 100:100:77
Confirmed for Hit At1g34020
Parent of DUPLO pair none
Parent of pair(s) 4322, 4330, 4331, 4344, 9968

Gene hit At1g34020

 
Sequence (A. th genome BLAST matches underlined)
>21-012074-strizhov-E3-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAAGCCATTTAGATTCG
GAAGATTCACAGCTGTATCGTTCCAAGTGCTGGGACACTTGAAGACGATCCTGGTGCTGA
TAATGGGCTTCTTCTTCTTTGGTAGAGAAGGTCTTAACTTGCACGTGGTTGTTGGAATGA
TAATTGCAGTACTGGGTATGATCTGGTACGGGAATGCCTCTTCAAAGCCAGGAGGCATAG
AGCGACGAGACTATTCTCTTCCAACTACCCGTCAACAGAAACTCGGAGCTGCTTCGGCAT
TCTGACGACAACGAAGACAAAGCCTATGGGATCCTCCCTATAGTGAGTCGTATGACTCAA
AAATCTATGGGATCCTCCCTATAGTGAGTCGANTTACTCANGNNNNNNNNGNNNNNNNGN
NNGANNNANNGCGNNGGGNGGGGCCGGNGCNGNGGGCTTTGGGGGCCAACCCTCCATGCG
GCATCGCCTAAAGGCGAGGAAAACATTGAAAAAACAAGGAAA
GenBank Accession BX942868 [GenBank]
Graphic View Graphic view of gene At1g34020
Predicted Position of Insertion Chr1:12368697 - go to primer design
BLAST e Value 1e-133
Hit Clone Code (BAC ID) F12G12
Hit Gene Code At1g34020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleotide-sugar transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR802936 [GenBank]


Last Updated on 31.08.2016 09:40