SimpleSearch - Line and FST details


Line specific information

 
Line ID 100B04
Vector Used pAC161
Line Availability only available from NASC (N409520)
Segregation Analysis 99:93:69
Confirmed for Hit At1g15180
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g15180

 
Sequence (A. th genome BLAST matches underlined)
>26-012073-strizhov-B4-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGCTGCAAGCTACAGCCT
ATGGGATCCTCCCTATAGTGAGTCGTATTACTCAGGTTTCTACGCAGAACTGATCCGGTT
TGGCAGATATTCCCATTGAGAACTGAGGCATGTGCACCTTTCCCCCAACACGGTGAGCGA
CGGTGCATCGGAGTGATCCACATGGGACTTTTAAACATCATCCGTCGGATGGCGTTGCGA
GAGAAGCAGTCGATCCGTGAGATCAGCCGACGCACCGGGCAGGCGCGCAACACGATCGCA
AAGTATTTGAACGCAGGTACATGGCGAACATGGGAGACGCAGAGAGCACCTCCAAAACTA
TGGGATTCTTCCTATAGGGAATAGTATTACTCAGTGCATGGAGAGATCTGCGAGATGGAT
TATTCACCGCAGAACTCAAGAGGCTTATCTGCTTTGCCGCTCCTATGGCGGCTGCTGTTA
TCGCTCAGTTCATGTAGCAGATCATCTCAATGGTGATGGCTGGTCACCCTAGAAATCTCT
CCCTCGCTATGGCATCCTTCGTATACTGAGTCAGCTGACCAACCGGCTTTAGAGGGAGGG
GCTGGTGGGCCCTTCATTTGCAATCCTTTACTCCCTAGGAAATACGGGGACCCTACATGG
GATCCCCCCCCATAGGGAGTTTGGGGGAACTGCCACTATANGGAGCCCCAGGGGCTCCCT
TCCTGATGGGAGCGCCGTTACTCAAGCGGCTGACAAGGATGCGGCGTCTTAATCGGGCTT
ATGCACCAGTCGTGGTGGTAGGTCAAATGGCGAGAGAAGCCGGGGGAGTGAGGCGCAATG
TCCTTCATAACTTTGTTTCTATTCTTCCTGCCTAATGTCCTCTGTATCACACAATAATTA
CATAGTATGAAACGATTAAAATTTATATATCGGAAACCACACACAAAAATAAAAG
GenBank Accession BX546532 [GenBank]
Graphic View Graphic view of gene At1g15180
Predicted Position of Insertion Chr1:5224181 - go to primer design
BLAST e Value 8e-67
Hit Clone Code (BAC ID) F9L1
Hit Gene Code At1g15180 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MATE efflux family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40