SimpleSearch - Line and FST details


Line specific information

 
Line ID 101A02
Vector Used pAC161
Line Availability only available from NASC (N409602)
Segregation Analysis 50:19:19
Confirmed for Hit At1g08460
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08460

 
Sequence (A. th genome BLAST matches underlined)
>09-012072-strizhov-A2-8409
GTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTAAAAAAAAATATATTCTTCGCTC
TCATAAAATAAAGAAAATATAATGGAATTTATTTATGATTCATTTTCGTATAAAAAACAT
TGGGCTACAAGTATCATGTACAAAACATTCGGCTATGGGATCCTCCCTATGGGGGGTCGA
TTACTCANNNNNGGAGANNCACATCNNTCCACTTGCTTTGAAGACGTGGTTGGAACGTCT
TCTTTGTCCACCATGCTCCTCGTGGGTGGGGGCCCATCTTTGGGACCACTGTCGGCAGAG
GCATCTTCAACGATGGCCCTTCCTTTATCGCAATGATGGCATTTGGAGGAGCCACCTTCC
TTTTCCACTATTCTCACACTAAAGTGACAGATAGCTGGGCCATGGAATCCGAGGAGGCTC
CCGGGTATCCCCCTGGGACGAAAAGGCCCATCCGCCTTTTGGTCTTCTGAAACTGGATCA
TTCGCCATCGTTAGTAAAAACCACGCGTGGCGGGCCTCACCCATGGTGACGAAGATTTTC
TTCCT
GenBank Accession AL755682 [GenBank]
Graphic View Graphic view of gene At1g08460
Predicted Position of Insertion Chr1:2672221 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08460 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone deacetylase 8
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03