SimpleSearch - Line and FST details


Line specific information

 
Line ID 102A03
Vector Used pAC161
Line Availability only available from NASC (N409699)
Segregation Analysis 50:47:44
Confirmed for Hit At1g72450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g72450

 
Sequence (A. th genome BLAST matches underlined)
>89-K034733-022-102-A03C-8409
GCCATTTACAATTAAAGCTCATGTGTTGTTGTTATAAATAACCAATTCTAGCCAATAAGT
TTCTGTGGCTTTTAACCTCTCCCGAATAAATAAAGAAAACGAAATAACGTGTTCTTTTTT
TTTATTTAGTCTGAAGTGACAGTGATGTGTGTCCAATATAGAATGTTTTTGTCACGAGTT
TTGTAACTTTTTTTTTTACACCTAACTGATCGATAGACATTTTTTTTTTTTTTTTAAACA
AAAAACTGATAAAAAAACAAAACCCCCTTTTTTTTTAAAAGGGTTAAAAAAAAAAAATTT
TTTTTTAGGGCAAAAAATATAAAGGGCAATAATTTTCCAAAACCCCCAAAGGTTTTGCCC
CAAAAAAAAAAAGGAAAAAAAATTAAAGGGGAAAAAAATAATTTTTCCCTAGGGTTAATT
AAAAAAATAAAACAAAAAGGTTCTTTAAAATTTCCGGCCCTTTTTCTTTGCAAAACCCGG
AAAAAAACTGTTGAAATTTAACGGCAACTTTACAAAAGGGGTTTACCCCTTTTAATTCTT
TCGGGCCCCAAAATTTTCTGTAAAAAACAAATTTCCCCTTCAAAGGAAATTCTTTAAGGG
GGGGTAAGAAAATTCTTTA
GenBank Accession HG968729 [GenBank]
Graphic View Graphic view of gene At1g72450
Predicted Position of Insertion Chr1:27276243 - go to primer design
BLAST e Value 7e-125
Hit Clone Code (BAC ID) T10D10
Hit Gene Code At1g72450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation jasmonate-zim-domain protein 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755768 [GenBank]


Last Updated on 14.10.2014 10:23