SimpleSearch - Line and FST details


Line specific information

 
Line ID 102C11
Vector Used pAC161
Line Availability only available from NASC (N409731)
Segregation Analysis 95:93:76
Confirmed for Hit At2g23290
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g23290

 
Sequence (A. th genome BLAST matches underlined)
>39-K015361-022-102-C11C-3144
GGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCAT
TTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAA
GCCATCATACTCTACCGGTAATTTTTTATCGTTAGTTAACAACAACTTAATTTTTTCGTA
ACTGTAAATTGGATTATTTACGTGCATAATTATGTTTTCAACTGAATCAAATTGAAATAA
GTTAACTGACACCAAATTAAATATGTAAGTATATGCCGTTTTGTTTTATTATTTTAAAAT
CCAGAAAACTGAAATTTAGTTTGAACCAAACAAAATAAACTCTAAACTAAAATTTATTAA
AATATATACTATTAAACAAATTATTATGTAATGTTTTTTTAATGAATGTTAAATTATAAC
TAAACATGTACTGTATTTCTAACTATAACTAAACAAAGATATTAAACTAAAATCAAATCA
TATTACATCAAATTATAAATGCAAACCTTTTTCAAAAAATAAATTCAAATTAAAAATTCT
TATATATTGTAGTTATGTAAAACTATTTAGAAAAACTACATATTTAAGTAATTTTGCGTA
ATTTC
GenBank Accession HG968730 [GenBank]
Graphic View Graphic view of gene At2g23290
Predicted Position of Insertion Chr2:9905986 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20D16
Hit Gene Code At2g23290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 70
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968730 [GenBank]


Last Updated on 31.08.2016 09:40