SimpleSearch - Line and FST details


Line specific information

 
Line ID 102F10
Vector Used pAC161
Line Availability only available from NASC (N409766)
Segregation Analysis 50:49:35
Confirmed for Hit At4g23420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g23420

 
Sequence (A. th genome BLAST matches underlined)
>78-K012380-022-102-F10-8409
CTGAAGCCTAAACACTTGAATATATCCTGAGTTCCCAATTGGTCATTTACAAATCTCAGA
GTTTGTGTTAATTTCTTCTTTCCTTACATCTTTTCCAGAAGAAAAAAAGCTGAAAGATGT
GGTTTTTTGGATCGAAAGGAGCATCTGGATTCTCTTCTCGTTCCACAGCAGAGGAAGTCA
CACATGGTGTTGATGGGACTGGTCTCACTGCCATTGTCACAGGTTTTCTTCTATCAATAG
TTTCATGCCCTTTTGCGACTTGGGTTTGTCTAAAGTTGTAGACTTTTCTATAATTATGAA
TTGATTTCATATGTAGGGTAGAGATTTTTTACTTTTATTGTTTAGACAATTGGAATTTGA
TGTTTTTATGATCAGGGTCTGTTTTTGGTTCGGTCAACCCTAATAAATATATGGAGGTCA
TCACCGTTTGTTGTTCTAAAGTTTGTCTTTTTTTTTTGCCAATAAGTAACAAGCTTTTGC
TCACAAAAATGGGATTGCTATGTTTGGGGAATTTTAAAGTACAACATGTTTGGGGACCAT
TTGATCTGCAAAAAACATGTGCTATTAGAAAGTTACATATATTTACATACTGGGCTTTGT
TTCAGCTGATTCTAAAGTTTTGGTAATA
GenBank Accession AL755828 [GenBank]
Graphic View Graphic view of gene At4g23420
Predicted Position of Insertion Chr4:12226201 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16G20
Hit Gene Code At4g23420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23