SimpleSearch - Line and FST details


Line specific information

 
Line ID 102H11
Vector Used pAC161
Line Availability only available from NASC (N409791)
Segregation Analysis 100:100:67
Confirmed for Hit At3g04710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g04710

 
Sequence (A. th genome BLAST matches underlined)
>88-K012501-022-102-H11-35St
GACAACTGACGTAAGGGACGACGCACATTCCACTATCCTTCGCAGACCCTTCCTCTATAT
AAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCG
GACAAAATACAATTGATCCATATCTTTTAATAAATTTGAATCTTAGACCCTCATATATTT
AACTATTACAAAATACACCCAATAATACGTTTTGTAAAAAATACACCCTGACTTCTCAAA
TCTCTTCATTTTCATTCTAACGTTAGATCAAAATGGGCTTATTTTCAGTTTAAGAATCGA
TTATCTATGGGATCCTCCCTATAGGAGGTTTTAACTCTAANNNNNNNNNNCNTNNCNTTT
CCTTCCTTTTTTCCACATTACACCCCTAGGTGTCCTCCCTTTCCTACCCCCATATTTTAA
NTTATATACAAACCCCAATCTCCATCTCTTTTTTTCCACATTTTATCAACTCATTTTCTT
TTATATCAAACCTTTATTT
GenBank Accession AL755860 [GenBank]
Graphic View Graphic view of gene At3g04710
Predicted Position of Insertion Chr3:1278024 - go to primer design
BLAST e Value 2e-89
Hit Clone Code (BAC ID) F7O18
Hit Gene Code At3g04710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ankyrin repeat family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03