SimpleSearch - Line and FST details


Line specific information

 
Line ID 103B06
Vector Used pAC161
Line Availability only available from NASC (N409810)
Segregation Analysis 50:38:28
Confirmed for Hit At2g30470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g30470

 
Sequence (A. th genome BLAST matches underlined)
>42-K012379-022-103-B06-8409
NTGATCCATGTAGAATTTCCCGGATATGAATGGGAGCAAGCAGAAAATAAAAACCAGCAC
ATTCCTACAGAAACCAGTTCATAGAAACCCCAACCTGCATGTCTCCAGCATTAGCTGCCT
TCCTGGAACCCATGATTAGTTTTCCGCCAGGATCAACCCGACTGAAAGTTACTGTAGAGG
TGAAAAACACAGAAAACCAACAATAGTTTTAGAAAATGGTTCATGAAAATTTGATGTTAA
AACCAGCAAATGCTTGAAGCTTTAGCTAAGACATGAACTATATTAAAAGTACCTGTATCA
CCAGCCTGTAGCATCATGGACTGTATGCATGGAGTGACACCTTCTAAAACATACATTCTA
CTATTGTTATTGGGCCAATATCTGAACTGGAACGTCCACTCCCTACCCCTCACATCTTGG
ATTTTCAAAGGAATGCCTTCGGATTGACTAATCGGAGGAAAATATGCCTATATACCAATG
CAGACATCAGTCATAACTCTACAAAATATTTCAAGGACAAGAAAAGACATCACCATAGGA
ATGGGAAATTTACCTCTGCACAGGCTTTTGGAAGAACTATGGGATCCTCCCTATAGGAGT
CTTNNAAAATTTAAAAGNNNTCTCAAGGAGAGGTACAATGTTCAAATCCAAACTATGGTA
TGCTACCATATAACGATGACTCCCCCCGACGTCTGGGGCAGAAATTCAATATTTGGCCAA
AGGCCCTTGGCAACGCTCCCTTTGACGGACCCGTGGTGATTGCCCTTTCCTGCCCTTAGA
AATAATTTGGGAGAAGTAATGAACGGATGTCTTCCTTGGGATTAAAACGCATTATTTCCC
CAAAGAGAATAAAAAGGATTTCTTGGAAAAAAATAATGAAGAAAGGGTTGAGGAGAATGC
GACACTCCCTTCAAAATTGCGCTTACCATGTAAAATGTTTTGTTTTTTAAAAAAG
GenBank Accession AL755877 [GenBank]
Graphic View Graphic view of gene At2g30470
Predicted Position of Insertion Chr2:12982723 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T6B20
Hit Gene Code At2g30470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation high-level expression of sugar-inducible gene 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755878 [GenBank]


Last Updated on 07.07.2016 14:03