SimpleSearch - Line and FST details


Line specific information

 
Line ID 103B07
Vector Used pAC161
Line Availability only available from NASC (N409811)
Segregation Analysis 50:50:40
Confirmed for Hit At5g23690
Parent of DUPLO pair 2468
Parent of pair(s) none

Gene hit At5g23690

 
Sequence (A. th genome BLAST matches underlined)
>50-K012500-022-103-B07-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTCATTCTGTTATATGTTGCTGCTGCAATTGAGACAATGGATGAGTCAGATGGTTTTGC
CACGGACAGTGATCGTCAAGACAAGGTTTCTGATGAACCAAGTAAGCTTAAGTCCATAAT
TGAACTGGAATTAGTCATCAATCCATTGTTCCTACTCATAATGTTAGGGTATCAACTCTG
TTCGATTTTGGTTGATTTGGAAAATGAAGGGGATCGTGAGTGGAAACAACTGAATTCGAA
AGATCTTGGACTAAGCAGCTCAATGATTGCAAAATCCACAAGAAAAGTGCTTAATGGCCT
TAAAAGCAAAGGTTGGTAGTTTCAAAGTCCTTAGATTTCTCTAAGTTTCGAAAACTTTGT
TCAACCATATCTCATACTGCTTCTGTAATCTGTAGGACATGATGTTTACCTTGTGGGAGG
CTGTGTACGAAATCTTATTCTGAAGCGGACACCCGAAGACTTCGATATACTTACCTCTGC
AGAACTTAGAGAGGTTGGNCTTGGTCTGGTTTTTTCTTTTCTTACTGGNCACATANTTTC
AATCTGATTTGGCATTGTTAACGTTTAAGTGGTTCGAACTTTTCCAAGATGTGAAATTGT
TGGAAAGAAGGTTCCTATATGTCACGTACACTTTGGAGATGATTAATAGAGG
GenBank Accession AL755880 [GenBank]
Graphic View Graphic view of gene At5g23690
Predicted Position of Insertion Chr5:7987843 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MQM1
Hit Gene Code At5g23690 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Polynucleotide adenylyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755879 [GenBank]


Last Updated on 14.10.2014 10:23