SimpleSearch - Line and FST details


Line specific information

 
Line ID 104G02
Vector Used pAC161
Line Availability only available from NASC (N409962)
Segregation Analysis 50:48:20
Confirmed for Hit At2g33100
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g33100

 
Sequence (A. th genome BLAST matches underlined)
>15-K012183-022-104-G02-35St
TTGCGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTCCATAATTGTAATGGCTTCAAGTCCACCCAAGAAGACCTTAAATT
CACAATCTTCTTCCTTAAGCCGGCCTCCACAAGCTGTCAAGTTTGGTCGCCGGACGTCCA
GAGGTCGCATTGTTAGCCTCTCCCGTGACGATGACATGGACGTCTCTGGTGATTACTCCG
GCCAAAATGATTACATCAACTACACCGTGCTCATGCCTCCAACACCTGACAACCAACCTG
CTGGCTCCTCTGGCTCCACCTCGGAGTCTAAAGGTGATGCTAACCGAGGTGGAGGAGGAG
GAGACGGGCCCAAGATGGGGAATAAGCTGGAGAGGAGATTGTCTGTCATGAAATCGAATA
ACAAATCACTGTTGTTGAGGAGCCAGACGGGAGATTTTGATCATAACAGGTGGGTTGTTT
GAATCTAAAGGAAAATACCGTATTTGGAAACGCGTTTCTGTTCAGAAGAAGATGATACCT
ATGATGGTGGGCGTTAAGCCAGTCCGAATTTCTTAAACAAGCCATGGGAAACCTTTCACG
AGGAAAAGTTCAGATCCCCGGCCAAATTCTTTAATCCCTACAGGGGAATGGTTTGTTTTC
ACATTTTTAAACCCCTCAAG
GenBank Accession AL756031 [GenBank]
Graphic View Graphic view of gene At2g33100
Predicted Position of Insertion Chr2:14040056 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F25I18
Hit Gene Code At2g33100 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cellulose synthase-like D1
Insertion Classification 5' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23