SimpleSearch - Line and FST details


Line specific information

 
Line ID 105D10
Vector Used pAC161
Line Availability only available from NASC (N410030)
Segregation Analysis 100:99:80
Confirmed for Hit At5g50430
Parent of DUPLO pair 12247
Parent of pair(s) none

Gene hit At5g50430

 
Sequence (A. th genome BLAST matches underlined)
>76-K012137-022-105-D10-8409
NTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAATATCCTGATATATT
TGCTAACAGTGATCAATTGACCATAACACTAAAGTGGTAACTTACTGTATACCCGAACCG
AGAATGAGTCTTGCTATCCTGATCACAGCGCTGTGTGTATCCAAACGCCACGTACTACGG
GTATGCCCACCTATTGAGTAGAAATACTACGAGATCCTCCCTATAGAGAGGCGCATTACT
CAGCCAGATAAGACTTACGCCATTCAAGAATGTCATTTGGGGAAGGACGAGCAACAACAT
GCGAGACTGGTTCCTATGGGATCCTCCCTATAGTGAGTCGANTTACTC
GenBank Accession AL756092 [GenBank]
Graphic View Graphic view of gene At5g50430
Predicted Position of Insertion Chr5:20535792 - go to primer design
BLAST e Value 1e-34
Hit Clone Code (BAC ID) MXI22
Hit Gene Code At5g50430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ubiquitin-conjugating enzyme 33
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03