SimpleSearch - Line and FST details


Line specific information

 
Line ID 105E10
Vector Used pAC161
Line Availability only available from NASC (N410042)
Segregation Analysis 50:40:32
Confirmed for Hit At2g30420
Parent of DUPLO pair none
Parent of pair(s) 2771, 95975

Gene hit At2g30420

 
Sequence (A. th genome BLAST matches underlined)
>77-K012137-022-105-E10-8409
TTGATCCATGTAGATTCTCCCGGACACTGAAGCACTTTACAGTTGAATATAGTCTTGTGG
ACATCTATCATCCTATGGCATCCTACCCTATAGCTGAGATCGTATTATTCACATACCTGA
GCCGATTACGCTATTCATGATGACATTGATAACCGATCCATGTGCGCCTGCCCCTCTAAA
GCATAAGCGAAATGTCCACTGTTCTATACTAAAGACGACTATATTCATCATCCCTCTATT
ATTGAAGCCTTACACTGTCTTTAACCTCATCACACTTTAATACAAGAAGAAAGTTTACTT
TCTGTTAATTATACATTTTATCAGTTTATCAACAACATAAAACTTTTTTTGAAATTATAC
AAGTAAAATACTCATGTCATTGCTTAAATATTGGCATGTCATTTTTCTCGAAACACGTTC
GAAAGTCTAAACTACTCTATGGGATCCTCCCTATAGCGAGTCGATTTACTC
GenBank Accession AL756102 [GenBank]
Graphic View Graphic view of gene At2g30420
Predicted Position of Insertion Chr2:12961083 - go to primer design
BLAST e Value 1e-74
Hit Clone Code (BAC ID) T9D9
Hit Gene Code At2g30420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Homeodomain-like superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23