SimpleSearch - Line and FST details


Line specific information

 
Line ID 106G12
Vector Used pAC161
Line Availability only available from NASC (N410164)
Segregation Analysis 50:38:26
Confirmed for Hit At1g63470
Parent of DUPLO pair none
Parent of pair(s) 11087

Gene hit At1g63470

 
Sequence (A. th genome BLAST matches underlined)
>95-K012499-022-106-G12-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGAAGCTGCAGCATCGACACCCGCGAGCAATTCAGAAGCTGC
AGCATCGACGGGTCAGCATACGCCACAGAACTTCCCAGCTCAGGGAATGAGCGGATGGCC
CGTTTCAGGCTCAGGCTCAGGCAGATCACTTGACTCTATGGGATCCTCCCTATAGTGAGT
CGTNTTACTC
GenBank Accession AL756211 [GenBank]
Graphic View Graphic view of gene At1g63470
Predicted Position of Insertion Chr1:23536994 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) F2K11
Hit Gene Code At1g63470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AT hook motif DNA-binding family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g06950

 
Sequence (A. th genome BLAST matches underlined)
>95-K012378-022-106-G12-8409
TGATCCATGTAGATTTCCCGGACATGAAGCCATAAACAGCTAGAACCTATACTCGAAGGG
ACCTCTCCGTATGATGACTTTTTTTACTAGTTTTGCTAAGTATTCATACTGAGTAAGGAA
TTGAGTCAACTCGGATGTGAATACTGAATAGTTTTTGTTCTATGGGATCCTCCCTATAGT
GAGTCGTATTACTCACTC
GenBank Accession AL756210 [GenBank]
Graphic View Graphic view of gene At5g06950
Predicted Position of Insertion Chr5:2151441 - go to primer design
BLAST e Value 8e-24
Hit Clone Code (BAC ID) MOJ9
Hit Gene Code At5g06950 [TAIR] [MIPS] [SIGnAL]
Gene Annotation bZIP transcription factor family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 14.10.2014 10:23