SimpleSearch - Line and FST details


Line specific information

 
Line ID 107A11
Vector Used pAC161
Line Availability only available from NASC (N410187)
Segregation Analysis 50:27:22
Confirmed for Hit At5g43170
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g43170

 
Sequence (A. th genome BLAST matches underlined)
>81-K012377-022-107-A11-8409
NTTTGATCCATGTAGATTTCCCTGACATGAAGACCTTTACAATTGACATTTGAATCCAAC
ACACACAATAATGATTGATTCTTTAAAACTAATAAAAACCTTGTCTCTAAACTTACGCCG
TATTTTACAATTAATATTCATCTATGGGATCCTCCCTATAGTGAGTCGTATATACCCAAA
AATAATTAGAATGGCCAATTTGGCCACCCACTCTCACTCTTCTTTCTCACGCAACTTCCT
CTCTTCTCAAGATTCTTCTCCATACTTCACCTTCTTCTATATATCTCTCTGCTCTCAAAT
TAGGTTTTAAATTTTCTATAGCAATGGCGCTTGAAGCTCTTAATTCACCAAGATTGGGCG
AGGATCCCTTAAGATTCAATGGCGTTGAGCAGTGGACCAAATGTAAGAAACGATCCAAAC
GTTCGAGATCTGATCTTCATCATAACCACCGTCTCACTGAGGAAGAGTATCTATGGGATC
CTCCCTATAGTGAGTC
GenBank Accession AL756235 [GenBank]
Graphic View Graphic view of gene At5g43170
Predicted Position of Insertion Chr5:17331896 - go to primer design
BLAST e Value 4e-93
Hit Clone Code (BAC ID) MMG4
Hit Gene Code At5g43170 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc-finger protein 3
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03