SimpleSearch - Line and FST details


Line specific information

 
Line ID 107F05
Vector Used pAC161
Line Availability only available from NASC (N410241)
Segregation Analysis 100:98:67
Confirmed for Hit At1g25500
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g25500

 
Sequence (A. th genome BLAST matches underlined)
>38-K012377-022-107-F05-8409
CATTGTTAAAGGAAGTCTACACATGAACAACTCAAATCATCAGAACTATTAAGTTGTTGC
CATTTGACCATAGGGGTTCAGTCATAGTTCAACCAGTTCAACCTCGGACGCACCTGTCTA
TAACTGAAATAACATACAAGAACTGCAACAGAGATCCAACAGCGAATGCACCGCCCCAAA
AGAACAGTCTGCACCAGAAACATAGTACACTAACTACAGCTATGGGATCCTCCCTATAGT
GAGTCGTTTTAC
GenBank Accession BX546534 [GenBank]
Graphic View Graphic view of gene At1g25500
Predicted Position of Insertion Chr1:8956752 - go to primer design
BLAST e Value 4e-115
Hit Clone Code (BAC ID) F2J7
Hit Gene Code At1g25500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plasma-membrane choline transporter family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX546534 [GenBank]


Last Updated on 31.08.2016 09:40