SimpleSearch - Line and FST details


Line specific information

 
Line ID 108C01
Vector Used pAC161
Line Availability only available from NASC (N410297)
Segregation Analysis 50:50:38
Confirmed for Hit At5g49945
Parent of DUPLO pair 2098
Parent of pair(s) none
Note Although the line exists, the insertion in At2g26660 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g26660

 
Sequence (A. th genome BLAST matches underlined)
>03-K012334-022-108-C01-35St
CTGACGAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCATATTGTCCTTCCCCGCCTTCG
GTTTAAACTATCAGAGTTTGACTGGATGTATTGGCGTCCTACCCTAAGAGCATCCGATCG
CCTATGCGAGGCTCTCTATAGTTGAGCTGATAACACGCATGAAAAATCTTCTGAAAGACT
GTAACACCACTTTCAAGCAGAGAGAACAACGGAATACATACGCCATTTCGAAATCTTATG
TATTGCATTTTAACATCTGTGGGTCAATCGGTCTCTGTACTCCTAACTATGGGATCCTCC
CTATAGTGAGTCGATTTACTCANNNNNNNNNNNNCNNNNNNCCCCCTTTCTTTCNCCCTT
CTTCCCTTGATNNCCTTACTCTTATTTTCACCGCACCACCCATCCATCAGTGCTAATTAT
ATTGGTATAAACAAT
GenBank Accession AL756350 [GenBank]
Graphic View Graphic view of gene At2g26660
Predicted Position of Insertion Chr2:11340817 - go to primer design
BLAST e Value 2e-58
Hit Clone Code (BAC ID) F18A8
Hit Gene Code At2g26660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SPX domain-containing protein 2 (SPX2)
Insertion Classification TS2TE (3')
Confirmation Status failed, line belongs to a contamination group, please check line 108E01

Gene hit At5g49945

 
Sequence (A. th genome BLAST matches underlined)
>03-K012313-022-108-C01-8409
TTGATCCATTGTAGATTTCCCGGACATTGAAGCCTTTACAATTGAGTATATTCTGACTAT
CGCCTCCACTCGCACGTTATTTGCCATCTTATGATCATCTATGATAGACTTCGTTGAAAG
TGGTGATAATGCTTGTGCTAGCCTGGGTGGATTTACATGAATGCGCGTAACCATGCTGAT
ATTGCCATGCTTATGGCCGCACATGACACCTACAACGTACTCGCTTGCGCTAGGCTACAG
GCATTGTCATAGAGAAAAGCAATGTGCAGAGTTTGACCGAGGATACGGTGTTCAAACTAG
AGCTCCCATTGGATATTGAAACGTGATGCGATTTACATATTCAGGCACGTGAAGATACCA
ACACCGACACATGACGATGAACCGAAGCCACTATAGTACCCTATCTTTACTGACTCCTTT
TACTGAATGCTTAAAGACACTAACGCTTCCTTCAACATATCTTACACTCACTCGAAAACA
ATAAGATCCATTCAAGTACACTACAAAAGTCTCCAAATCAGACTGAACTCAGAAATGAGC
TGATATTGGAACTGCCAAATTCTGTGACTACCAGTTCTCACTCTGCTAATAATTGATCCT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession AL756349 [GenBank]
Graphic View Graphic view of gene At5g49945
Predicted Position of Insertion Chr5:20319075 - go to primer design
BLAST e Value 2e-98
Hit Clone Code (BAC ID) K9P8
Hit Gene Code At5g49945 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation hypothetical protein (DUF1682)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40