SimpleSearch - Line and FST details


Line specific information

 
Line ID 108E01
Vector Used pAC161
Line Availability only available from NASC (N410321)
Segregation Analysis 50:49:28
Confirmed for Hit At2g26660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26660

 
Sequence (A. th genome BLAST matches underlined)
>05-K012334-022-108-E01-35St
TTGACGAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTACAGTATATTAATCGTTATGTAACTCTATTACAATTACTTGCTCNATGACAATGTG
CCGCAGTGCGTACTATGGTACTCTTTCTTTTGCTAGATATANTGCATGAAAAATCTTCTG
TAAGACTGTAACACCACTTTCAAGCAGAGAGAACAATGAAATACATACGCCATTTCGAAA
TCTTATGTATTGCATTTTAGCATCTGTGGGTCAATCGGTCTCTGTACTCCTAACTATGGG
ATCCTCCCTATAGTGAGT
GenBank Accession AL756374 [GenBank]
Graphic View Graphic view of gene At2g26660
Predicted Position of Insertion Chr2:11340810 - go to primer design
BLAST e Value 5e-71
Hit Clone Code (BAC ID) F18A8
Hit Gene Code At2g26660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SPX domain gene 2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g25050

 
Sequence (A. th genome BLAST matches underlined)
>05-K012313-022-108-E01-8409
TTGATCCATGTAGATTNTCCGGNACATGAAGCATTTACAATTGAATATATACTAGTACGA
TCATGGCATTTGAATCACTCCTTATTTTGATATACAATATGACTATGGGATCCTCCCTAT
AGTGAGTCGTATTACTCACNGGCATATCTGNTAAAAGCATTTTATGTTATACATAGCTAA
TTGTCTTTCCAAGTCAAGAGAGGAGTAACATTCTGTGTTTGTTCAGGTTATATTTTCGGA
GATGGGTGCTGGTAAAAAGCTTGCCTCTGTTGATCTGCCACATATGGAGGAAAAAGATGT
TTTACCTATGGAAGCATTTGCTAAGGTTCAAGAGATATTTAGTGAAGCTGAATGGTTGGA
TCCAAATTCTGATGTTGCTGTGACTGTTTTCAACCAAATAACAGCAGCAAATATCCTTCA
AGAAAGCTTGGATTCAGGTTCTCCTCGAAGCCCTGACTCACGTAGCCTATTGGAATCGGC
ACTTGAGAAAGTTAAGGAGAAAACCAAGTTGATGATATCGGAAAATATTGTTCCAAGTCC
TGATACATCCTCTCCTGAAGAAGAAAACGATCCACGCCCCTCTCTTAAATCTTATGCCGA
ATCCGAATTAATTCCTTA
GenBank Accession AL756373 [GenBank]
Graphic View Graphic view of gene At2g25050
Predicted Position of Insertion Chr2:10658258 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F27C12
Hit Gene Code At2g25050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Actin-binding FH2 (Formin Homology) protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03