SimpleSearch - Line and FST details


Line specific information

 
Line ID 109C11
Vector Used pAC161
Line Availability only available from NASC (N410403)
Segregation Analysis 98:41:27
Confirmed for Hit At1g66230
Parent of DUPLO pair none
Parent of pair(s) 2809

Gene hit At1g66230

 
Sequence (A. th genome BLAST matches underlined)
>83-K012312-022-109-C11-8409
TTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAAACATAAGCCGTTAGA
CCTTATCTGCAGCGATTCACAATGTCTTACATCCACGTCACACATCTTCGCATTCTTGCT
AATGATTCGAGTTTCTTGAAGGATTTGCAGTTCCCGGAGTTCGAGTGGTCCGACTATGGT
AATAGTAATAATGATAATAATAATGGTGTGGACAACATTATAGAGAACAATATGATGAGC
CTGTGGGAAATTAGTGACTTTAGCAGTTTGGATTTGCTGCTTAATGATGAGAGTTCTTCC
ACTTTTGGGTTGTTTTGAATTCATTCTTAAAAATATGGTTTCTTTTGTAAAAGAATGGAA
ACTATGGGGTGGGGGAAACAGAAAA
GenBank Accession AL756448 [GenBank]
Graphic View Graphic view of gene At1g66230
Predicted Position of Insertion Chr1:24677986 - go to primer design
BLAST e Value 2e-163
Hit Clone Code (BAC ID) T6J19
Hit Gene Code At1g66230 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 20
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23