SimpleSearch - Line and FST details


Line specific information

 
Line ID 110D02
Vector Used pAC161
Line Availability only available from NASC (N410502)
Segregation Analysis 100:80:38
Confirmed for Hit At5g26030
Parent of DUPLO pair none
Parent of pair(s) 837

Gene hit At2g16510

 
Sequence (A. th genome BLAST matches underlined)
>12-K012311-022-110-D02-8409
TGATCCATGTAGATTTCCCGGACTGAAGCGGTTTATCGGTTCCGTTCACTGAGGAGGCTG
TTCTGCAGGTGTGATTTGCTCTCCTGTTCGATGGAGCTCTGCTTATGTTTGTGTCATAGT
CATGTTTATCTTAACAAGCTAATCTCTTTTAATCTGATAAAGAAGGACAAATTACTACTG
GGATCCTCCCTATGACGAGTCGATTTACTCAGCTTCCTTGGCGCCGCCGCCGCTCTCGTG
TTCTCCTGTACGCCATGACCTTCTCCTCTCACTCGATTCTCTTCCAATTCGTATCATTCC
CTTTGATCTGATCCAGATGATTGCTTCTATGGGATCCTCCCTATAGTGAGTCGTTTTACT
C
GenBank Accession AL756536 [GenBank]
Graphic View Graphic view of gene At2g16510
Predicted Position of Insertion Chr2:7160924 - go to primer design
BLAST e Value 5e-53
Hit Clone Code (BAC ID) F1P15
Hit Gene Code At2g16510 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATPase, F0/V0 complex, subunit C protein
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At5g26030

 
Sequence (A. th genome BLAST matches underlined)
>12-K030270-022-110-D02-8409
AGCGGTATTGGTATCCGTTCACTGAGGAGGCTGTTCAGCAGGTGTGATTTGCTCTCAGTA
TTGATGGAGTTTCTTATGTTTGTGTCATAGTCATGTTTATCTTAACAAGCTAATTTCTTT
TAATCAGATAAAGAAGGACAAAATTACTAGACTTGTTGTATGGGATCCTCCCTATAGTGA
GTCGTATTACTCACGTCCTT
GenBank Accession CR934550 [GenBank]
Graphic View Graphic view of gene At5g26030
Predicted Position of Insertion Chr5:9097395 - go to primer design
BLAST e Value 6e-85
Hit Clone Code (BAC ID) T1N24
Hit Gene Code At5g26030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferrochelatase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL756537 [GenBank]


Last Updated on 14.10.2014 10:23