SimpleSearch - Line and FST details


Line specific information

 
Line ID 110D02
Vector Used pAC161
Line Availability only available from NASC (N410502)
Segregation Analysis 100:80:38
Confirmed for Hit At5g26030
Parent of DUPLO pair none
Parent of pair(s) 837
Note Although the line exists, the insertion in At2g16510 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g16510

 
Sequence (A. th genome BLAST matches underlined)
>12-K012311-022-110-D02-8409
TGATCCATGTAGATTTCCCGGACTGAAGCGGTTTATCGGTTCCGTTCACTGAGGAGGCTG
TTCTGCAGGTGTGATTTGCTCTCCTGTTCGATGGAGCTCTGCTTATGTTTGTGTCATAGT
CATGTTTATCTTAACAAGCTAATCTCTTTTAATCTGATAAAGAAGGACAAATTACTACTG
GGATCCTCCCTATGACGAGTCGATTTACTCAGCTTCCTTGGCGCCGCCGCCGCTCTCGTG
TTCTCCTGTACGCCATGACCTTCTCCTCTCACTCGATTCTCTTCCAATTCGTATCATTCC
CTTTGATCTGATCCAGATGATTGCTTCTATGGGATCCTCCCTATAGTGAGTCGTTTTACT
C
GenBank Accession AL756536 [GenBank]
Graphic View Graphic view of gene At2g16510
Predicted Position of Insertion Chr2:7160924 - go to primer design
BLAST e Value 5e-53
Hit Clone Code (BAC ID) F1P15
Hit Gene Code At2g16510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATPase, F0/V0 complex, subunit C protein
Insertion Classification TS2TE (5')
Confirmation Status failed

Gene hit At5g26030

Sequence (A. th genome BLAST matches underlined)
>12-K030265-022-110-D02-8409
AGCGGTATGGTATCCGTTCACTGAGGAGGCTGTTCAGCAGGTGTGATTTGCTCTCAGTAT
TGATGGAGTTTCTTATGTTTGTGTCATAGTCATGTTTATCTTAACAAGCTAATTTCTTTT
AATCAGATAAAGAAGGACAAAATTACTAGACTTGTTGTATGGGATCCTCCCTATAGTGAG
TCGTATTACTCACTTCCTTTTAATAATACGGCTGCGGACATGTATGTTATCCTCCCTATT
TTGAATTTGATTTTCCCTTTTCTTTTTGTAATTCTTTTGAAACTGTTTCTTTTTTTTTCC
AATTTTNTGTGGAAGGGTTCNNATTTTTTTCTATGAGCAGGTGGGAGAGAGAATGGGGGT
AG
GenBank Accession CR934549 [GenBank]
Graphic View Graphic view of gene At5g26030
Predicted Position of Insertion Chr5:9097402 - go to primer design
BLAST e Value 9e-81
Hit Clone Code (BAC ID) T1N24
Hit Gene Code At5g26030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferrochelatase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Woodson et al. 2015, fc1-2]
Other FSTs Supporting this Hit AL756537 [GenBank] CR934549 [GenBank]


Last Updated on 31.08.2016 09:40