SimpleSearch - Line and FST details


Line specific information

 
Line ID 111E03
Vector Used pAC161
Line Availability only available from NASC (N410611)
Segregation Analysis 50:23:15
Confirmed for Hit At1g14440
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g14440

 
Sequence (A. th genome BLAST matches underlined)
>21-K012310-022-111-E03-8409
TGATCCATGTAGATTTCCCGGACCATGAAGCCTTTACAATTGAATATATCCATGTAAACT
TCTTTCGAAGTGCGTTTCGTCAGCTTTTGTTTGCGCATGGCTTGCAATAAGAGCTTTATT
TTCCTTAATTACCATTATTTTGCATACTTTCATTATGGCCTATACTTATGAGATTGGTAA
ATTGCGGCTGCCCCTTTTAGAAAAAATAATTTGAAAAATGCTCTCCGGGAGTTGATACTA
AAAAAGAGGAAACTTCTTAAGACTTTAATCAACAAAGGATTCACCTTTAATAGTTTAATC
ATTTTGGTATTAGTTACTAATATTTTCCTCCAATTGTCTTGTTTTCTTCTTAGCTATGGG
ATCCTCCCTATAGTGAGTCGATATACCTCACANNNNNGNGACAGATNGCTGGGCAATGGA
ATCCGAGGAGGTTTCCGGAAATTACCCTTTGCAGAAACGTCTCACCTGCCCTTTAGAACC
TCTAAAAATGCATCAATGGAAATATATGAAAGACAGAGACGGCCCGCGCCCCCCACCTGG
CCGAACAAGCAGACAGGGCCTACACCACGAGACCACACAGCACCCGCGGTTCATTCGTAC
GACAGCCCTGAACGAGGGCGTTTCCGCACCGCCCCCGACCAGAGACGACGCAGACTCACG
AGGCGAAGTGCGGCTACTAAGACGAAAGAAGCCCGCAAAACGGCGGGACCAAGCGCAGAA
ACAGCTGCAACTCCGACGCCGCCCACGCACAGACCACGCGGACACCATCAACACGACGAC
GCACCAACGAAAGAGAGCACACACCACCGGTGCCCGCGCACACGAAAGAGANCAGAGACA
GCGATGATAGCAAACCACGGGGACACATCCACAAAACAAAAAGGAAGGC
GenBank Accession AL756643 [GenBank]
Graphic View Graphic view of gene At1g14440
Predicted Position of Insertion Chr1:4940390 - go to primer design
BLAST e Value 5e-87
Hit Clone Code (BAC ID) F14L17
Hit Gene Code At1g14440 [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein 31
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23