SimpleSearch - Line and FST details


Line specific information

 
Line ID 112E05
Vector Used pAC161
Line Availability only available from NASC (N410709)
Segregation Analysis 100:95:90
Confirmed for Hit T15N24
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit T15N24

 
Sequence (A. th genome BLAST matches underlined)
>37-K014766-022-112-E05-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACTATCGGCTTATATGGGATCCG
ACCTATATGGAGATTTTAATTGTTGAGTAGCATATCAATGGAGCAGTGAACATGACCGTA
ATTGCATATTGTGGTCTCGTTAAGTCTGACTATAACAAACTGTTGCCAGTTTGTAGTAGA
TATTNACTTAACTTTTATGGCATACTTGGGATCCTGCATTCCATGAGAATATATATGGTG
GAGATAGTTTGAATCAAGATCAGCTCTCTGTGAAGAAATAGGAATTATATAGAACAAGGC
CTCGTCCCATTCCTAACCTAAGAAGATCCCGTACATAATGTTGCTTACTTTTTGTTTTAC
GGACCCGATTGTACTCTCCCCATGTTGGGCGGATATGGGTAAGATGAATTGTTCAAGGAC
GAGATGTCACCATTTTGAGTCTCGTTCTTTGTTTCTCTCTGGCCGTACTGATTCATACCG
CTATTTAAGCTATGGGATC
GenBank Accession BX285156 [GenBank]
Graphic View Graphic view of sequence BX285156 of line 112E05
Predicted Position of Insertion Chr4:13437000 - go to primer design
BLAST e Value 6e-148
Hit Clone Code (BAC ID) T15N24
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03