SimpleSearch - Line and FST details


Line specific information

 
Line ID 112E05
Vector Used pAC161
Line Availability only available from NASC (N410709)
Segregation Analysis 100:95:90
Confirmed for Hit T15N24
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g26640

 
Sequence (A. th genome BLAST matches underlined)
>37-K014767-022-112-E05-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCATTTACTATACTGCTTCTATGGGATCC
TACTTATATGGAGATATAAATTGCTGACTTGTTGATCAATGGGCAATGGACATGACCGTA
ATTGCATATCGTGGTCCTTAAGCAGACAATTACAACTGTTGCCTGTTTTTCAATAATAGT
TTCTCAACTTTTAGTCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL756736 [GenBank]
Graphic View Graphic view of gene At4g26640
Predicted Position of Insertion Chr4:13437073 - go to primer design
BLAST e Value 8e-27
Hit Clone Code (BAC ID) T15N24
Hit Gene Code At4g26640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL756736 [GenBank]


Last Updated on 31.08.2016 09:40