SimpleSearch - Line and FST details


Line specific information

 
Line ID 114A12
Vector Used pAC161
Line Availability only available from NASC (N410860)
Segregation Analysis 104:104:102
Confirmed for Hit At4g32980 T22O13
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g32980

 
Sequence (A. th genome BLAST matches underlined)
>89-K012566-022-114-A12-35St
NTTTCTGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATA
AGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGC
CTTCGGTTTAAACTATCAGTGTTTGAAGAACATCCTAGAGATGGGTTTTCTTTGCTTCTA
ATGCTCTCCTTTGAAATGTAGATCCGAAACCCGCCTCCGAGTTATTAGAATCACCATCAT
GAAACTCAGCTATATTCTCCAAACGTGAAGTAAAGGCTGAACTATGGGATCCTCCCTATA
GTGAGTCGTTTTACTCATATTTCGACGTGTCTACTTTCACGTGCAAATGGGGGCTTAGAT
GACAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCATTTCATCTTCGG
ATTGGCCTGAGATTATGCGAAAATATACACTCCTATACATGACTACTGACAGTTTGAGCT
ACCAATTCACTGTAACCCATTACCTTACATAATGCACTCAAATGCTATGGGATCCTCCCT
ATAGTGAGTCGTNNTACCTCACACCTCCTTCACCCCGGACAATCCTTACTCTTCTTAACT
ATCTACTTTATGATGATGACCTTGGTAACTCGATTTTATAGCCAAGGTATGGTTTATTTA
ATG
GenBank Accession AL756855 [GenBank]
Graphic View Graphic view of gene At4g32980
Predicted Position of Insertion Chr4:15916027 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) F26P21
Hit Gene Code At4g32980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation homeobox protein ATH1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL756855 [GenBank]

Gene hit T22O13

 
Sequence (A. th genome BLAST matches underlined)
>89-K012504-022-114-A12-8409
ACTTGATCCATGTAGACTTTCCCGGACATGAAGCTCTTTACACTTGAAAATCATAAAAAT
GTATCATGGCAATGCAAATCTATGTTTAAAAATTTATCAGCCAAAATAAATAAAGTTTAT
TTGCCTGGTTCCGCCTTTATCTTCAAAATTTCCCTATTCCTTTATATAGTTTTCTAAATC
ATATTTTCTCTTATGTTTTCTTTGCGTTGCCAGTACTTGTGTTTGAAGATAGTAATGGTA
CATTGGAAAATAGACCACATGGTCCACAATTCCCGGAAATTCATTACTCTTCGAATTAAG
CATCCATCCATAGTTAAAACACATTTTGACATAGTAATGTATCTATGGGATCCTCCCTAT
AGTGAGTCGTTTAACCTCACCNGCGCCACCCAAGACACCGGCACCGGTGAGACTACTCCA
AGCACGTACTTAATTCTCTTATCATATATATATATATATATCTCCCCTCTCTCAAAGAAA
AAGAATCTGTGGGAGACCCCCTCTATAGA
GenBank Accession AL756854 [GenBank]
Graphic View Graphic view of sequence AL756854 of line 114A12
Predicted Position of Insertion Chr2:11640622 - go to primer design
BLAST e Value 4e-146
Hit Clone Code (BAC ID) T22O13
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40