SimpleSearch - Line and FST details


Line specific information

 
Line ID 114C03
Vector Used pAC161
Line Availability only available from NASC (N410875)
Segregation Analysis 50:50:45
Confirmed for Hit At5g58430
Parent of DUPLO pair 2578
Parent of pair(s) none

Gene hit At5g58430

 
Sequence (A. th genome BLAST matches underlined)
>19-K012504-022-114-C03-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCTCTTGGAATATGATGCTGGGGTTGCTGA
AGGTGGATAATACTGCAGCAGGCATGAACGGTTTGGGGAAGACCATGAATGATAAGCTGA
GGCAGTTCAATATTCAGTTTGATGAAATATGTACAGTGCATTCGACGTGGGTAGTGTTTG
ACGAGCAGCTGAAAGAAGAGCTAAAGATCTCACTGGCCAGGCTTTTGGTACCGGCATACA
GGAGCTTCATCGGCCGGTTCCAAAACCTTGGAGACATAGGGAAAAACGCAGACAAGTTCA
TCAAGTATGGAGTTGAGGACATAGAGGCGCGTATTAACGAGCGTGCTCAAGGGACTACCA
CGGCAAGAAAATGAAGGTTACGAGCACCAATATAGCCTCTTGTAACATCTTCGTAGCGAA
CCACCTGCTAGATGACCAATACCGAAGTCTTGCAAGGAGGATTTGTAGCATGTGTTGCGT
ATGCTTTTAGACAGTTAGCTCAGCTCTGTTGTGTTGATGTGTACCTGTAGATCCGATACT
GGATCACTTTTTATAGTCCTTGCAAAAAGAGAATACAGTCTGAAAAAAATGACATGTTTA
GGGACTTGGAATCTACCTTCTAAATCTTTGAGTGCCTATTTTTATCAATATGTTTCTTAC
ATTCTAGGTCTTCCCTTTTTAACAAAGGAGTCCACACAAGGATTTTTCATTTTTTTTACT
GGGTTCTCAATTATATTGGTAACCTTTCACCCGGTAACCCTTACGCACTTGTGGGATCCT
CCCTATAGTGAGTCG
GenBank Accession AL756866 [GenBank]
Graphic View Graphic view of gene At5g58430
Predicted Position of Insertion Chr5:23621806 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MCK7
Hit Gene Code At5g58430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein B1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40