SimpleSearch - Line and FST details


Line specific information

 
Line ID 114D09
Vector Used pAC161
Line Availability only available from NASC (N410893)
Segregation Analysis 100:97:69
Confirmed for Hit At2g35940
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g35940

 
Sequence (A. th genome BLAST matches underlined)
>68-K012504-022-114-D09-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTCTACTCCTCTATGTATAATTAGTAG
TTGTTACCACGAATGAAACGACGTCGTTTTCTTTGATTCTCTTTCAATTCTTGACCTTCT
TTCACCAAGCTGATTGATATCATAGAAAAACAAACAAAAGTATGAAAAAGGAGCAAAAAC
AAAACCACTATAAGTTTAATATAGATCTGTATATATATACAGTTGAAGCGAAGAAAAAAA
GAATCGTGATCACATCAAGAAGACGAAGAAGAAGGGATGAATTATGGATTATGAGAAAGA
GAGATTGAAGGATATGGAAATTAAGACATAATCATGATTGAAAATAAAATAATAAAATAA
TAGAGTTAGAAATTGAAAGAAAAAATGAATATTATAAAAGATGAAGAACCTGGATTGATA
GAGATCTGAGGATGCACGTGTTTCATGATCATCTCAAGCTGCAAAAGGAAAGTTACATTA
GAGAATTTCTATCANAGAGAAAGAGAGAGAGACAGACACACACACATACACACGAATATA
CACTTATATATATATATNTATATGCATACCTGTGTTTGTGGAGATGTGTGTGATTGCTAT
GTGANGTTGGTCTCTGTGTCAAACTCAAAGATCTCTGCAACTCTTTTCTTGCTCAAAGGG
GAAATAATAAATACATTTAAAAAGCGTGGGAAATATTTTTTAACAAAATAAAAATGACCT
ATTTTTTTTGAAAGAGAGAGGAGGGTAAAGAAGGGAGAGATAAAAGAACCCCTCTTTTCC
TT
GenBank Accession AL756879 [GenBank]
Graphic View Graphic view of gene At2g35940
Predicted Position of Insertion Chr2:15091716 - go to primer design
BLAST e Value 3e-69
Hit Clone Code (BAC ID) F11F19
Hit Gene Code At2g35940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation BEL1-like homeodomain 1
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03