SimpleSearch - Line and FST details


Line specific information

 
Line ID 115B08
Vector Used pAC161
Line Availability only available from NASC (N410964)
Segregation Analysis 100:100:67
Confirmed for Hit F4C21
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F4C21

 
Sequence (A. th genome BLAST matches underlined)
>58-K012503-022-115-B08-8409
TTGATCCATGTAGATTNTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGAAAAG
CAATGGATAAAAAGTGCCCACACGCAGGATCGAACTACGGACCTTCAGTTTACAAGACTG
ACGCTCTACCACTGAGCTATACGGGCCTTTGATTTAATCTTTCAGTAATGTATTTAAATA
CCTGTTTTGATTGCAAACACACCTGATCTTACATGTACCATTGTCAACAAACAAAAGCTA
ATTACTCCCAAAGTGACCCTTGAAAACGGGAAATTAAAAAAGAAACTTGGGAAGTGAATG
AACATAATATTTCATATAAGAGGCAAGAATTCACAGAGTAATTGCGATGAAATGTAGCTT
ATACATTATAAGAACATTCAAACAAGTCTTACACAAAAAGACCAAATCTTTCTCTTTTTC
TTGTTGAAGAGTCTTAAGACCACCATGGAGCATCACCAGTCCTGAAGTCAGTTTCCACCC
ATGGAACAAAAAGAACCTTCCCAGCTTCATCTATATCCGCGTGAGCCAACGCTATGGGAT
CCTCCCTATAGTGAGT
GenBank Accession BX285159 [GenBank]
Graphic View Graphic view of sequence BX285159 of line 115B08
Predicted Position of Insertion Chr4:1442094 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4C21
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03