SimpleSearch - Line and FST details


Line specific information

 
Line ID 116C06
Vector Used pAC161
Line Availability only available from NASC (N411070)
Segregation Analysis 100:100:76
Confirmed for Hit At2g26510 At2g26510
Parent of DUPLO pair none
Parent of pair(s) 4984, 5006, 5007, 10207, 73594, 73600, 73603, 73607

Gene hit At2g26510

 
Sequence (A. th genome BLAST matches underlined)
>43-K012564-022-116-C06-35St
TGGCGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTACAAAGACATGATAAACGCGCAAGTATAAAACGAGCTTTAACCTGTTTCTC
GGAATCGAATTGACCATTGTTGTAATCTCTGATTATAGACAATACGGGAAGAACATACGC
GAACGATACTCCCATAACCGTGGGAAGCCTTGTCCCGATAAGCGTTTGTAGCAACGTGTT
TATGCCCGACATAAACAATATAGTCTGGATAACCCGCGCTTTATCACCCTATTATCGTTC
AAAATACCAAACGGTCGATTTCAGAATCATATAATAACATAAATATTAGACAACCGGATC
CAAAAACCAAAAACATCACATACAGGATCTCCACCCATTGGTGACACTATGGGATCCTCC
CT
GenBank Accession BX511282 [GenBank]
Graphic View Graphic view of gene At2g26510
Predicted Position of Insertion Chr2:11275236 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T9J22
Hit Gene Code At2g26510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g26510

 
Sequence (A. th genome BLAST matches underlined)
>43-K012502-022-116-C06-8409
TGATCCATGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATATGGACATATT
GCTGATTAATATTTCTACTTATAGTGTTTCTTTTTCTTAAATGTGATGTCGCGGTGAATT
GTGGTGCAGTTCAACGATATACTTAATACGATATTTGCTTCGGCTCCGTTGGTGGCGACC
ATTCTTGCGACCATACTATGGGATCCTCCCTATAGTGAGTCGTTATACTCAAACNCNNGA
GGAATCCCGTGGTGGAAGCCCTTCCAGCACAGGAACGGAGACGGCAGGAACGATGAGTTC
TATAGTATGCCCCTTAGAATCAACGAGTTAATGCCGACACGGTTCCTTTGAAGACTGCCC
CTGAACGTTTCTTCTGTATTTGGAAATGTAAGATATGATTATGTGCATACCTTGTAGCTT
CATTGGGGAAAAATTGAGTCCAGTGGATACAAATGAACATAGGCCTTTGATGGAAAAAGC
TATTTTTTTGCAAACTATATAACTTGTGTTACTATGGGATCCTCCCTATAGTGAGTCGTT
TTCCTC
GenBank Accession BX511281 [GenBank]
Graphic View Graphic view of gene At2g26510
Predicted Position of Insertion Chr2:11277172 - go to primer design
BLAST e Value 5e-142
Hit Clone Code (BAC ID) T9J22
Hit Gene Code At2g26510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil permease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03