SimpleSearch - Line and FST details


Line specific information

 
Line ID 116E01
Vector Used pAC161
Line Availability only available from NASC (N411089)
Segregation Analysis 100:98:88
Confirmed for Hit At3g23210
Parent of DUPLO pair 2547
Parent of pair(s) none

Gene hit At3g23210

 
Sequence (A. th genome BLAST matches underlined)
>05-K012502-022-116-E01-8409
NTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATTGAATAAATATATTTGCA
GCTAATGATTTCTCTTGGTCTCCACTATGGGATCCTACTTATTGTGACCCGTACTATTTA
CCTCAAACTCTTCCTTAACAGCTCCAACAGATGACGAAGAATTGATTTCCACTACACCAC
TAAACACCTGTCCTTGTTGCTGCTGCAAATGAGGCACTGCAGAATCGTCGTTTTGTCCTC
TAAAGCCACAGACTTGATGTGTCTCTTGCTGCAAAACTCCACTAAACGATGCAGCCAAAT
CCAATTGTGCTGATCCAATGCTACTACTATAAACAACTCCATTGTTTCCTCCTCTAAAGC
TACTACAAACTTGCTCAAGATTTCCATTAAAAGAATCAAATTGTTCTTGTTGTGGCTGCA
TCAGATTCACACCACAAGACCCAAAATCCTGAAATATGTTATCTTCATTTGTTTGCATAT
ATCCATAAGGATCTTCTACTCCATTGCTACAGAATCAAGGTAACAACAATCTCCATCAAC
AACAATAACGACCGCTATGGGATCCTCCCTATAGTGAGTCGTTTTAC
GenBank Accession AL757019 [GenBank]
Graphic View Graphic view of gene At3g23210
Predicted Position of Insertion Chr3:8284238 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K14B15
Hit Gene Code At3g23210 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23