SimpleSearch - Line and FST details


Line specific information

 
Line ID 117H08
Vector Used pAC161
Line Availability only available from NASC (N411228)
Segregation Analysis 95:91:69
Confirmed for Hit At4g23430
Parent of DUPLO pair none
Parent of pair(s) 63556, 94759, 94760, 94761, 94764

Gene hit At4g23430

Sequence (A. th genome BLAST matches underlined)
>64-K012519-022-117-H08-8409
CTGATCCATGTAGATTNNTCCCGGACATGAAGCCTTTTACTAATGGTGAACCAAATAGTA
ATTCTTCTATCAAAATCTAACATTCTTCCTTGGTTTGGTCTCCGTTGCAGTTACAGTAGT
ATGCGAGCTTATGGACAATCTAAACTCTGCAATGTGTTGCACGCCAACGAGCTTACAAAG
CAACTGAAGGTAACTATGGGATCCTCCCTATAGTGAGTCGTATTTACTC
GenBank Accession BX649701 [GenBank]
Graphic View Graphic view of gene At4g23430
Predicted Position of Insertion Chr4:12230682 - go to primer design
BLAST e Value 1e-84
Hit Clone Code (BAC ID) F16G20
Hit Gene Code At4g23430 [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAD(P)-binding Rossmann-fold superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [H├Ârmann et al. 2004, tic32-kln]


Last Updated on 14.10.2014 10:23