SimpleSearch - Line and FST details


Line specific information

 
Line ID 118C04
Vector Used pAC161
Line Availability only available from NASC (N411260)
Segregation Analysis 100:98:60
Confirmed for Hit At1g75940
Parent of DUPLO pair none
Parent of pair(s) 6228, 6248, 6250, 6255, 6256, 70077, 70171, 70174, 70179, 70183, 70188, 70189

Gene hit At1g75940

 
Sequence (A. th genome BLAST matches underlined)
>27-K012518-022-118-C04-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGAAAAT
ACCCTGTAACGTTTACTTTATCATCGCTGCATTAAAACACACGAACAAAAAAAACATTAG
TCCATCTGAAGAAAATAATTGGCATATTTTCATCGAATTAAAACTCAAAATATGATTTTT
TAACATACCAAATTGCTTCGTGCAAGCTCAAGAGATGTTTCTGGATATAGTATGTTCTGT
GCTGATCTGACAGCGCCACTACAAGGCTTGTGTCTTGCTCACCTATGGGATCCTCCCTAT
AGTGAGTCGTTTTA
GenBank Accession BX649703 [GenBank]
Graphic View Graphic view of gene At1g75940
Predicted Position of Insertion Chr1:28513857 - go to primer design
BLAST e Value 6e-114
Hit Clone Code (BAC ID) T4O12
Hit Gene Code At1g75940 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glycosyl hydrolase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40