SimpleSearch - Line and FST details


Line specific information

 
Line ID 118G07
Vector Used pAC161
Line Availability only available from NASC (N411311)
Segregation Analysis 100:99:74
Confirmed for Hit At4g28530
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g28530

 
Sequence (A. th genome BLAST matches underlined)
>55-K012518-022-118-G07-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCTCTTTACAATGGATATATAATCCTATGC
TTTTACGACCTGTATTACATCACTATATATCATTGATGACACTACAGGCTTGATGTTGGA
AATGAGATGGCTTTCATACTTACACTAGTATCTTTCCTGTGAAAAACGGCTTATACCTGA
AATACAATGATCTATGAATAAAATACTAAGTCTATATGTCAACAAATATCTTACATGACT
GCACATACGTATTGAAAGATTATAAACTATTACACTTTATGCCATCCATACACATAACAT
AGCACAGTTTACTTAAGAGTCAACTATTGGCAGTGAACATAGGACATCTCCCTCACATTG
AGCAATTTTTACTGATTTATGATATGCTTATACTTACAAACCGAATCTTCTTGTTCGTGA
TTCTATGGGATCCTCCCTATAGTGAGTC
GenBank Accession BX649704 [GenBank]
Graphic View Graphic view of gene At4g28530
Predicted Position of Insertion Chr4:14094339 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) F20O9
Hit Gene Code At4g28530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 74
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03