SimpleSearch - Line and FST details


Line specific information

 
Line ID 120B05
Vector Used pAC161
Line Availability only available from NASC (N411441)
Segregation Analysis 100:99:67
Confirmed for Hit At5g62470
Parent of DUPLO pair none
Parent of pair(s) 3497, 3592

Gene hit At5g62470

 
Sequence (A. th genome BLAST matches underlined)
>34-K012516-022-120-B05-8409
NTGATCCATGTAGATTTTCCCGGACATGAANGCCTTTACAATTGAATATATAGAACAAAA
ATGGCTTCATGTAGATTATCTACATTTTTATTTAATATCTCTAATTACCATTTAATCCCT
TTTTCCTTGAGTTAATTGTTTTGTTAATATGGTGTTTTAGGTTTGAGAAGATGTAGCAAG
AGCTGCAGATTGAGATGGACTAATTATCTTCGACCCGGTATTAAGCGTGGAAATTTTACT
GAGCATGAAGAGAAGACAATTGTTCATCTTCAAGCCCTTTTAGGCAACAGGTATATTTTA
ATGCACATGATCCATATTTTTCCAAAAAGTTACCTTTCTTGGGTATAAGATCTAAATATG
TTTTTCTTTGTATATAGATGGGCAGCCATAGCATCATACCTTCCAGAAAGGACAGACAAT
GATATAAAGAACTATTGGAACACTCACTTGAAGAAGAAGCTCAAAAAGATTAATGAATCT
GGTGAAGAAGAAATGATGGTGTCTCTTCATCAAACACTATGGGATCCTCCCTATAG
GenBank Accession BX890762 [GenBank]
Graphic View Graphic view of gene At5g62470
Predicted Position of Insertion Chr5:25080548 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) K19B1
Hit Gene Code At5g62470 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 96
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03