SimpleSearch - Line and FST details


Line specific information

 
Line ID 120D06
Vector Used pAC161
Line Availability only available from NASC (N381361)
Segregation Analysis 50:49:1
Confirmed for Hit At3g21820
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g22110

 
Sequence (A. th genome BLAST matches underlined)
>44-K012516-022-120-D06-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAAGCAAAATCAAAGAA
GAACCGAACGAGAGAGAGAAACGAATTCTTCTCAGGTATTCTCTTAAATCCAATGTCTTT
CATTCTCCTACTTGTTCCTATAGTATTCATGACTCTGTGGATCTTCCTTTCCTGTTTAAT
TTTGCTGGATCTGTCTTGAGCGAAGTGTTTTCTTATGAAATCTTCAAACTTTTGATAGAA
TTTTATAAACCCTATGGGATCCTCCCTATAGAGAGTGGTATGACTNCAAGGAGNNNNTAT
ATGGGCATCAGTGATTGTTGAATTATCTTTCGATTTTTCTCTTCGCTCCTGTGATTGTGA
CTTTAGGTTTGTGTTGATCTCAAAGTAACATAGATTTATAAAGCTAGGGCATCCTCTTTA
TATTGAAGAAACTT
GenBank Accession AL757281 [GenBank]
Graphic View Graphic view of gene At3g22110
Predicted Position of Insertion Chr3:7794120 - go to primer design
BLAST e Value 8e-98
Hit Clone Code (BAC ID) MKA23
Hit Gene Code At3g22110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 20S proteasome alpha subunit C1
Insertion Classification TS2TE (5')
Confirmation Status unknown

Gene hit At3g21820

 
Sequence (A. th genome BLAST matches underlined)
>44-K012823-022-120-D06-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTGCTTTGATCTCTGGCAGAGACTTGGTGGTAGCATCACCAGTAG
AGGACTATTTCTTGTATATTGATGATCTTCCTGATGCAGAAAAGGTCTGAACAGAGTAAT
GCTTTCCACCTGTTTGTTCTTTGACCAAAATCTATCGACGCTTACCAGTTTCTTATTCTC
ATTATGATAGGAAGAAACCGAGGAAATCACAAGACCGTTTCTATGGGATCCTCCCTATAG
TGAGTCGANTTACTCAANNNNNNNNNNCNGGNNGGNNNCCCNNNCCTTTNCCCCGGGGTC
CCCCCTGGGGGGGGGGCCCCTTTTTGGGGGCTCTTGGGGGGCTCCCCTGGAACCGGTCTT
GGGAATCCTTGGTTCCTCCCTATCTAAGAGAAATAAGAACCTGGAAGCGGCATAGAATTT
GTGAAGAAACACAGGGGGAAAGCTTTCTCTGTGCGACCTTTTTGGCGTAGGAAGAAATGA
TATTCAAAAAATGTCTCTCTGGGGGATCTCCCACAAGTTTGGCAAGATAAAACCACTGAT
GGGTTAACCAAGGCGGGAAACGAAATCGAGCC
GenBank Accession AL757282 [GenBank]
Graphic View Graphic view of gene At3g21820
Predicted Position of Insertion Chr3:7689423 - go to primer design
BLAST e Value 2e-113
Hit Clone Code (BAC ID) MSD21
Hit Gene Code At3g21820 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone-lysine N-methyltransferase ATXR2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40