Line specific information

Line ID 120G09
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis unknown

Gene hit At1g68030

Sequence (A. th genome BLAST matches underlined)
>71-K012516-022-120-G09-8409
CCGATGACTTAGAATTGGCTCCTAAGCTTCCAGATTCTTTGGGTGAATATACAAATGAGA
TGGTAGCTTTCAGATGCCTA
GenBank Accession AL757316 [GenBank]
Graphic View Graphic view of gene At1g68030
T-DNA Border 81 base(s) before start of sequence
BLAST e Value 3e-30
Hit Clone Code (BAC ID) T23K23
Hit Gene Code At1g68030 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PHD finger protein-related
Insertion Classification CDSi
Confirmation Status unknown