SimpleSearch - Line and FST details


Line specific information

 
Line ID 121D05
Vector Used pAC161
Line Availability only available from NASC (N411561)
Segregation Analysis 50:50:48
Confirmed for Hit At4g14690
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g14690

 
Sequence (A. th genome BLAST matches underlined)
>36-K012552-022-121-D05-8409
TTGATCCATGTAGATTNTCCCGGACCATGAAGCCTTTACAATTGATTATAGGACTAGACG
TTATCCTTCATCCTCTTACATTCACTGACTAAGACATAAGATTCAACATGCCTCGGTCGG
ATTCGCTATTCATCTGATTATAAAAAACCTATATAAATATGGTCACTGGATACTTTATCA
GAGCCTGGTGTGTTATCCGCTCTATGGGGAGAGGAGAGTGCTCACAACACTGATAGACAA
TACCCGGCTCCGCATTACTAGGATTGCTACCGTAGGAGACAGATGGATGGCTCACGTATA
TATACACTAACCTCATAGTACTTCCACTTCCCTACGTTACTTATTTGACTTTAAATCCTG
ACCGAACCCTACAGTCGACTATTTAACTAGGGCGATCCTAACAAGGAAGATGCTTCTGTG
CCCTCACTCTCGAGTTCGGCCACTACACCACAGATGCCACAGTCTCCTCCTACACCAGTT
AGCAAGCCTAAGGTATGATCTAATGATCAAAGTCATTAATATATATCACTAGCTAAAACA
ATGAAGCTAAGGAAGATTTTTCTTATTGGCTATGG
GenBank Accession AL757356 [GenBank]
Graphic View Graphic view of gene At4g14690
Predicted Position of Insertion Chr4:8418271 - go to primer design
BLAST e Value 6e-105
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g14690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chlorophyll A-B binding family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03