SimpleSearch - Line and FST details


Line specific information

 
Line ID 121G06
Vector Used pAC161
Line Availability only available from NASC (N411598)
Segregation Analysis 50:48:37
Confirmed for Hit At1g22150
Parent of DUPLO pair none
Parent of pair(s) 5665, 5721, 5734, 5741, 8689, 8709, 10414, 83026, 83033

Gene hit At1g22150

 
Sequence (A. th genome BLAST matches underlined)
>47-K012552-022-121-G06-8409
TGATCCATGTAGATTTCCGNGACATGAAGNCATTTAAACTTGAATATTTACTGATTTCAA
GACTCGCTGTCCTATGGCACTCTCCTTATAGTGAGTCGTATTACTCAGANNNNCCNNCCT
AGNACNTTCCCACCCCNNAACATANCCAAGAGAACTGCAAAACCTATCAATTACACATAT
GGTACTGTTTTCTTGGGACTTACGGCTATTAGAAGGCCAATCTCTACGGATACAAAGATG
ACACCAAAAAAAGCCCCCATACAAGCAACAAAATCGAGCTTATCGATCTTGAAGATCAAA
ATGGTCGCATTAACGTCAACCAAAGGAATCACAGCGTGGATGATGATCGCTGCAAGAATT
GCGTTGGGTGTGTATTTGAAAAGAGGAGTGAGGAAGAGAAGCGTTAAGAGGACGACAATG
GACATGATGATGTTGGAGACTGCCGTTTGACATCCGGCCATAAAGTTGACGGCGGATCTT
GAGAAAGACCCGGTGGATACATAGCAAGAGGTCATTGAACCGATTACGTTCATTGCTCCT
AATGCTACCATCTCTTTGTTACCATCGATTTGGTAGTCTTTCATTGGTGAAATGGTCTCT
CTATCGCTTCAGCTTCCTGGTACAAAGATTTGCGCTTGCCTTTACGGTTACCTATTAAAA
TCAAAACAATTAGTAAAACATTAATTTTAGGGTTT
GenBank Accession AL764138 [GenBank]
Graphic View Graphic view of gene At1g22150
Predicted Position of Insertion Chr1:7820624 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F2E2
Hit Gene Code At1g22150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sulfate transporter 1;3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03