SimpleSearch - Line and FST details


Line specific information

 
Line ID 122C01
Vector Used pAC161
Line Availability only available from NASC (N411641)
Segregation Analysis 23:9:6
Confirmed for Hit At2g31660
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g31660

 
Sequence (A. th genome BLAST matches underlined)
>03-K012551-022-122-C01-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATGTGCACTTTGTAACTCGA
GGATCAGCTCTTATATGATCATATTTGTTTACCTGAAATGGCACAAAGAACACTTATATC
GCGATTGGAATGACTCACTATATGTATATACTAGAGATGTGAGACCAAACAAAGAATAGC
AGGTACGGAACTCCGGACCAATCCTATGGGATCCTCCCTATAGTGAGTCATATTACTCAT
GGCTTCTGACGTGTTTAGACATCTCCAAAACGCAGCCGCCTGAACAAAAGCAAAGGCAGA
AATACATATTTATTACCAAGTTTGAGTATTCAAGAAATATCAACTCAGAGAACCAATTTT
TCTTACCAGATTTTGACATAATCCAAAAGCAAAAGGAGCCATCTCTTCGCCAAACTTATC
TACGATGGTCTCCAAAGTAAAAACAAGGTCCTCATTCTCTACCTCATTCATGAGTTTGAA
AAATTCTGATGGACGCAGGATCACAATAAGTTTGAAGCGTTAGTTTACTTCAACAATACT
GACCATCTATGGGATCCTCCCTATAGTGAGTCGTATTACTC
GenBank Accession CR356271 [GenBank]
Graphic View Graphic view of gene At2g31660
Predicted Position of Insertion Chr2:13468817 - go to primer design
BLAST e Value 8e-175
Hit Clone Code (BAC ID) T9H9
Hit Gene Code At2g31660 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03