SimpleSearch - Line and FST details


Line specific information

 
Line ID 122F04
Vector Used pAC161
Line Availability only available from NASC (N411680)
Segregation Analysis 116:111:79
Confirmed for Hit At2g45910
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g45910

 
Sequence (A. th genome BLAST matches underlined)
>30-K012551-022-122-F04-8409
NTTTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATCTCTGATAGGG
ATATCTTCCTCTCTCTTGTTCTTCTCTTATCCGTAGACTCTAGGGACTCAATACTATTCG
AGTGTGTCTGTTTGCTCTCTATTCAAAAATTTCACTCTGGTTAGAAACTTTCCCTTTTGG
ATTGTGAAACTGCTATTTTAAATCACTGCTTATTGATTCGTGTTCCGGAGTGATCTTGGT
GAATATTCTTAATTTGTTTCGTTGTTTTGTGGTTTTAGATATCAAACGATCTGGTTTGTC
GGATTTGATATTGGAGCAATGGCTTTGGTGAGTCCAATTCCAGCAATGGGTGAAAGAGCT
GGATCCATGAGATTTCACGGAATTGGTAGCCCAGGATCAAGGTCTAGTAGGAGCGGGATT
ATGGACGAACCTGTCTCGCGGCTGATTGACGAGAAGATCTTCGTTGCAGTGGATAAACAC
GTGGCCAAGAGCAAATCTACACTCATTTGGGGCTTTGCAAAACACTGGAGGCAAGAAGAA
TTGCCTTATTCATGTTCATCAGCCCTCCCAAATGATCCCACTTAGTATGTTCCCTTACAC
CTTGTCTCTGTGCTCTTTTTTCACTTAGTCTTTGTTGGNGGCACTGGATCTTGTTTTTTC
ACATTGATTCATCCTATGGGGCGCCAA
GenBank Accession CR356273 [GenBank]
Graphic View Graphic view of gene At2g45910
Predicted Position of Insertion Chr2:18894262 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F4I18
Hit Gene Code At2g45910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation U-box domain-containing protein kinase family protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03