SimpleSearch - Line and FST details


Line specific information

 
Line ID 122H03
Vector Used pAC161
Line Availability only available from NASC (N411703)
Segregation Analysis 50:48:36
Confirmed for Hit At2g39550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g39550

 
Sequence (A. th genome BLAST matches underlined)
>24-K012551-022-122-H03-8409
NTGATCCATGTAGATTNTCCCGGACATGAGAGCATTTACAATTGAATATTTCGCACGGAA
AGAGACCTTTACGACCTCGTTCCTCTGATATGGCAGCCTTCCTATAGGGCGTGAGATGTG
ACTATCCGATCGTCCATTTGGATGTGCATGCCAACCACAGGGTTCCCCTCGGGAGTGCTT
GGCATTCCCTGCGATATTGACTTCTGTTCAACCACCCACACGTTGGAAAGCCTGACGACG
GAGCACCATTGACAAAAATATCCCTTGGCTCGACTGGGACGGCTATGGGATCCTCCCTAT
ATAGAGTCCTTATACTCAATATGCATGTGATGAGGATCTTCAAAGAACGTTCAAGGACAC
TTGGATCCACCTTTGGAGTTTTTCATATCACGGTAGCAAGGACATTCATCTTTGTGTCCA
AAAGTTCCCGAAGGAACACAATTACACTTCTGGCAACATATATTGCAGTACTTGAGGCAT
TCTTCATGTTGGCCTGCCTTTGAGCATCTCACATTGCACTTTCCACCGCATGCTGCTAAT
TCATTTATCACATATATATGTAAAATCTTAGAATTTCAGAGAACCTGTTTCAAAATGATA
CATGCATGACCTACAATTATTAACTATGGGATCCTCCCTATAGTGAGTCGATTT
GenBank Accession AL764200 [GenBank]
Graphic View Graphic view of gene At2g39550
Predicted Position of Insertion Chr2:16501533 - go to primer design
BLAST e Value 5e-164
Hit Clone Code (BAC ID) F12L6
Hit Gene Code At2g39550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Prenyltransferase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770200 [GenBank] CR770200 [GenBank]


Last Updated on 31.08.2016 09:40