SimpleSearch - Line and FST details


Line specific information

 
Line ID 123F11
Vector Used pAC161
Line Availability only available from NASC (N411783)
Segregation Analysis 50:38:29
Confirmed for Hit At3g07710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g07710

 
Sequence (A. th genome BLAST matches underlined)
>86-K012812-022-123-F11-8409
ACTCTTATGATGACAAATTAGCCTGCTGAAAATGTTGACAAACCTCTGGTAGAATGAGGC
TAATGATAAGGAGAAGGAGGAAGATGGTGCTGCTGATGAGCTGTGCGCTTTACAGGATGC
GCTTGAGACGACACTGTTTCAGCATTTAAGCAACTATGCACAGAAGCAGATGTTACAGAA
GTTGAGGAGCCTTACAGCCAAGGAAAGGAAAGAGTTGAGCGGGGAATGGAATTCATTACT
TGCTCAGGAGGCGCTACTGAAGAGCAAGAAATATTCGTTTTCAGCCGAACTCGCAAATGC
AACATTTCATACTTGGGAACAAGAAACTATGGGATCGTCTTTGTGATGGGGCTCCTTACC
TATAGTGTTTCCTAGTTGCTCATGTACATGACGGGATGGGTTCCTGCCCGTGATCTCCAC
GGTGGGGAATCCTTTCTGTTGTGGTGACCTGTTGCATATTTTCGTTTTCTTCGTAAATAT
GAAAGGTTTGTCCTTTCTCTTTGCTTGAAATTTACACATTTGTTGTTCAGCTCCGCTTTT
TAAAAAAATTAACCCGTATAAAATAGGACTACACCCCTTTTAAATAGAATTACTTACCGG
AGCGGGGGTCTCCCTTCTCCATTCCACAAGGTAGAAAAGAATGCTGGCCCGCTTTTTTTT
NTTATTTGGACCCCACCTATAAACGTGAGGATGTTTTATACCTGGAACGGCAGTTTTCCC
ACAACTCTTATTGGCATAAATTATTGGCCCTCAAAAGCCAAAAAGATATNTGTGTCTCTG
TCCTTTACAATCCATTATTTTTTTTCTTATATCCGCCACAAGGGGTTAAATATTGTTTTT
TG
GenBank Accession AL764264 [GenBank]
Graphic View Graphic view of gene At3g07710
Predicted Position of Insertion Chr3:2464697 - go to primer design
BLAST e Value 2e-157
Hit Clone Code (BAC ID) MLP3
Hit Gene Code At3g07710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03