SimpleSearch - Line and FST details


Line specific information

 
Line ID 123G05
Vector Used pAC161
Line Availability only available from NASC (N411789)
Segregation Analysis 50:46:33
Confirmed for Hit At5g64510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g64510

 
Sequence (A. th genome BLAST matches underlined)
>39-K012812-022-123-G05-8409
ACTTGGATCCATGTAGACTTTCCTGGACTGAAGTCATTTACACATTGGATATATCCTGTC
CGATGTTATTTGATCTCTGTGGAGCTCCTCGGCCATAGAGCACAATGGGAGCCTTCCTAT
AATGACTCGCAAAACAAAAAGATTTCAATAGAAACCTTTGATCTTTTATACGGGGTCTGA
CGCTCAAAGGAACGAAATCTCACGTTAAGGGATTCCGGTCTTGAGATTATCAAAAAGGAG
CTTGGCCTATGTGAGACTCCCTAGAATGAGTGGTGAAACGTACTTGGATACCAATCCGAG
GAAGTCAAGGTTTCTGGGTTTGATATAAGGGATGCATTGGGCGGACATTCTGTTGCATAC
GAATTTGATTTAAAAATCGACAATAAAGCTCTCCCATTTAAGCTTCTTGAAGATGTGAAC
CGATGGGAATACGTTGATCTCCCAATTTTCCAAGTAGAACAACCCTCTGAGAATGGGTTG
GTTCCTATGAGGAACAAGAAGACATCTATGGAATGCTCCCTATGGTGAG
GenBank Accession AL764270 [GenBank]
Graphic View Graphic view of gene At5g64510
Predicted Position of Insertion Chr5:25784725 - go to primer design
BLAST e Value 1e-108
Hit Clone Code (BAC ID) T12B11
Hit Gene Code At5g64510 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03