SimpleSearch - Line and FST details


Line specific information

 
Line ID 125A02
Vector Used pAC161
Line Availability only available from NASC (N411906)
Segregation Analysis 100:99:96
Confirmed for Hit F15B8
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F15B8

 
Sequence (A. th genome BLAST matches underlined)
>09-K012814-022-125-A02-8409
TTTGATCCATGTAGATTTCCCGGACATGAANGCCTTTACAATTGTAGATACTCATGATCG
CTACAGTAATGATCATGATGGTATGAGACAAATTTTTAAGATTCGCCTTCGAACTGAGCC
ACGCAAACTTTCTGTCGAGAAAAGAAAACACCAAAACTGAATAACCTATGGGATCCGTCC
CTGTAGGGACGTCGTATAACTAGGGGGTTCCGCGCGACGACCATCGCAGCCCAGCCATGG
GATCCTCCGTATGCCGGACGACGGAACATACTTGCAAGAACACTGCTTGGCTCGTTTGGG
GCGGATATGGGAACCGCACTATCACTACCCATGTCACTTATCCAAAACGCTACACTAAAT
CCAAAACCGTTTGTGTACTTGTGAATCTTGATCTACCTTAAATTGCGTTTACTGAATCTA
AGCTCCCGTCGTAGTCCCAGATGGAAGGGAAGGATACATCATGCTCAAAATCATAGCTTC
CGAAGTTGCTGGAGACAAATTGCATGGTTGCGGGTTTCACTTCTTGGCATCTCGATCAGG
GCCTCCCAGCTGACATTCTCAGTTCTGGAAGGACTTTCCGTTTCTTCTTGCTCGGTCCAT
GGTGG
GenBank Accession BX285161 [GenBank]
Graphic View Graphic view of sequence BX285161 of line 125A02
Predicted Position of Insertion Chr3:21334028 - go to primer design
BLAST e Value 6e-108
Hit Clone Code (BAC ID) F15B8
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR803544 [GenBank]

Gene hit At5g57815

 
Sequence (A. th genome BLAST matches underlined)
>09-K012923-022-125-A02-35St
TACTGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCGGTGTTTGAACCCATTAAACAAAGATAAAGACTTATGTTTAGGGC
CAATTAAAGCCCAACAAAATGGGCTACTTCTGAATCTGTAGATGTACACGGCCGAACCGT
AAAGATATGAGTGTCGTATACTGAGTTACCCACTCGACGCTGATGTCTTCTATGCTTATG
TCATTTCTCCAATTCATTTGATCCATAATCCATGGATGACAAGGTGACTCGTCGCTCCTT
TATGTATCTCGCAGCTACGTATACCTA
GenBank Accession FR803543 [GenBank]
Graphic View Graphic view of gene At5g57815
Predicted Position of Insertion Chr5:23426578 - go to primer design
BLAST e Value 5e-28
Hit Clone Code (BAC ID) MTI20
Hit Gene Code At5g57815 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Cytochrome c oxidase, subunit Vib family protein
Insertion Classification Promoter
Confirmation Status unknown


Last Updated on 14.10.2014 10:23