SimpleSearch - Line and FST details


Line specific information

 
Line ID 125A08
Vector Used pAC161
Line Availability only available from NASC (N411912)
Segregation Analysis 100:95:88
Confirmed for Hit At4g30020
Parent of DUPLO pair none
Parent of pair(s) 3970

Gene hit F28D10

 
Sequence (A. th genome BLAST matches underlined)
>57-K104601-0022-125-A08-8409
TAGTTTTAATTCTACTTAGATACACAGTACACACATGTCTTTCTACTTAGACCTAAACCT
GTACTTCTATGGGATCCTCCATATAGTGAGTCTTTTNTAGCTGGGTCNTCTTCCNNTCTT
ANTGTTGCTGAAACTGCGATGCTTCTATGGGATCATCAGAAATATAAAGGGGTAATGAGG
AGAGGATAAGATAGGGAGAAGATTGGGGGAAGAGAGGGAAAAATGAGATAAGGTAAGTGA
GGAAGGAATAGAAGGTTGAAAGGTAAGGAAATGAGAAAATGGGAAGAGAGAAAAGGGGGA
AAGTGAATTAATGAGAGAAAGGTGGTATTAAGTAAAATAGAAAAGAAGAGGAGGGGAAGG
AGAGAAAAAGTTTAAAAAATGGGGAAATGAGGGTGAGAAAAAAAAGTGGAGAGGAAGAAT
TGAAGGATTAAGTATAGTAAAGAATTGTAGAGGAGAAGGAAAGAAGGAAGTTGGGTAAGA
TATTAGAGAGGAAAGGAAGAATTATAGAGAATTGTAGAGGGGTGAATATAATGAAAAAGA
GAGGTAACGATGAGTATAAATATATGAAGGGTAGTAATGGGATTATGGATGAGAAAAGAT
TAAAAGGGAGAGTAAGAGTATAAATGAGTGAAGATAAGATAGAATGAGTAATAAAAGGTA
ATGAAATGAGGATAGAAAGGAAAAGAAAAAGAGGAGGGAAGAGAAATGGAGAGAAATAAT
AATGTTGAGGATGGATGGGAGGAAGGTGAGAAAGTAGAGAAGGAAGTGAGATATGAGTGA
AATAGAGATAGAAAATGGAAAAATAAGGAAGGAGTAAAAATAGAGATATAGATTAAAGAG
GATAGAAAAGATAGAGAGAAAAAAAAGAAAATGAATAAATAAGGAGAAAAAGAAAAGAAG
GAAGGGAATGTGGAAAGAGAGAAGACAGGGAGGATATAGATTAAAAAGTAAAGAGTGAGA
TAAGATTAGAATAAAAGGAGGATAATAGATAGATGATAAAAAGTTGGAGAAGAGTATAAT
GAAATTGATAGATGATGGAGAAGAAATGTGGAAGAGAGGAAAGTGTGAGGAAGTTGTAGA
GTGAATGAAGTATTAGAAAAAGTGAGGGATTATATGAATAAAGGAATAAGAGTAAAGTAA
TTAATTGAAAAATGTAAAGAATAATAGGGTAGAAAATATATGGAATGAA
GenBank Accession FR803561 [GenBank]
Graphic View Graphic view of sequence FR803561 of line 125A08
Predicted Position of Insertion Chr3:16378067 - go to primer design
BLAST e Value 1e-07
Hit Clone Code (BAC ID) F28D10
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit FR803561 [GenBank]

Gene hit At4g30020

 
Sequence (A. th genome BLAST matches underlined)
>57-K012814-022-125-A08-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCAGTAGTTTAGCTTCTACTTACTACAA
CATACACACATGCTTCTACTTAAACCTAAACCTGACTTCTATGGGATCCTGGCTATAGTG
AGACGTATTACGCAGGTTCAGCTTCCATCAAGAAAGTTGCTGAAACTGCCAAGCATCTAT
GGGATCCTCCCTATAGTGAGTCGTATTACTACAAGGGGNGCNGACGCGGNTGGGACGTGT
TCTTTTTCCAGGATGCTGGTATTGGGTGGGGGTACATCTTTGGGACCACGGTCGGCACAG
GCATCTTCGGGGATGGCCTTTCCTTTATGGCAAAGATGGCATAAGAAGGAGCCGCATTAC
TTTTCCTCTATCTTAAGAATAAAGCGACGTATAGGAGGGCAATGGAATCCGAGGAGGTTT
CCGGATATTACCCTGGGTAGAAAAGGCTCAATGGCCCTTTGGGCTTCTGAGACTGGATCT
TTGATATTACAGGAGTAGACAAGCCGGGCGTGCTCCA
GenBank Accession BX649706 [GenBank]
Graphic View Graphic view of gene At4g30020
Predicted Position of Insertion Chr4:14680266 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) F6G3
Hit Gene Code At4g30020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation PA-domain containing subtilase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649706 [GenBank]


Last Updated on 31.08.2016 09:40