SimpleSearch - Line and FST details


Line specific information

 
Line ID 125C01
Vector Used pAC161
Line Availability only available from NASC (N411929)
Segregation Analysis 50:42:30
Confirmed for Hit At2g47260
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g47260

 
Sequence (A. th genome BLAST matches underlined)
>03-K012923-022-125-C01-35St
NAACTGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAA
GGAAGTTCATTTCACTTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGC
CTTCGGTTTAAACTATCAGTGTTTGGGAATGGTTTAAACTTTCCGGCAATAGCATGTTAA
ATATACAGTACGGATGGTTACGGACTTCCAGTAACCGGATATATCACACGAAGGTTTTTT
CAAAATACTGTACTCATTGGTCAACGCGTAAGTCAGAGAAGACAGTGAACGCTTTCATAC
GTGCGGTTTTTGACTGGTTTAATTAAACCGGTTTTTACAGCTATGGGATCCTCCATATAA
TGAGTCATATTACTCAAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAA
TGGGGGCTTAGATGAGAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCC
ATTTCATCTTCAGATTGGTCTGAGATTATGCGAAAATATACACTCATATACATAAATACT
GACAGTTNGAGCTACCAATTCAGTGTAGCCCATTACCTTACATAATTCACTCAAATGCTA
TGGGATCCTTCCTATAGTGAGTCGTTTTA
GenBank Accession AL764392 [GenBank]
Graphic View Graphic view of gene At2g47260
Predicted Position of Insertion Chr2:19406734 - go to primer design
BLAST e Value 4e-81
Hit Clone Code (BAC ID) T8I13
Hit Gene Code At2g47260 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 23
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03