SimpleSearch - Line and FST details


Line specific information

 
Line ID 125E08
Vector Used pAC161
Line Availability only available from NASC (N411960)
Segregation Analysis 50:49:39
Confirmed for Hit At3g50850
Parent of DUPLO pair 1331
Parent of pair(s) none

Gene hit At3g50850

 
Sequence (A. th genome BLAST matches underlined)
>61-K104603-0022-125-E08-8409
GCCATTTCTCGACTTAGCCCAACTTGAGCGTTTGCGTCGGCGTTGAATTTGAGATTCTCG
ATTACGTTTGGGAGATCCGTCACCGTGACATTAGCACCTATGGGATCCTCCCTATAGTGA
GTCGTATTACTCACGGGGCTATAGCGAATTGGGAGTCCTAAAATCTTGCGCCATGAACGC
ATAAGCNGGTAAAGAGTACATGTGTTGAGCTACCAATTCANTGTAACCCACAGAGAAAAG
AAAACCGTGGAAGGGAGGAGCTGTTGGGGGGGGAGATTAGGTGGCGAGAGATATTATGAG
AGAAAGATGGGAGAAAAAGAGTGAAGTTGATATGGCAGGGGTAAGAGGAAGGATAAGTGA
ATATGAAGGGAATTGGATAAGAGAAATAGAGAAGCGAGAAGAAGAGAATATGAATTGCAG
AGATGAGGGAGATAGGGGATGAAGTGGAAAATAGAAATTGAAGAGGAGAAGTAAAATAAT
GAAGAAAAGTTATAAAATGAGGGAGGATAAAGAGGAAATGGAACGTGAGAAGCGATATAG
AAGAGAAGAAAAAAGAAGAAGATATAGTAGGAAAGTAGGAGAGAAGATTTATTAAAGGTT
AGACGAAACAGAAGGGAAAGAGAGATGGGTATAGGTGAGACAAAGAAGATAAAGGGAGAA
AGGAAAAATAATGAGAGGGAAGAGAAAAGAAGTAAAGATATAAAGGAATAGGAATGAAAA
AGAGATGTTACGAAGAAAGAGAAAATAATGAATGAGATAGATGAAAGGGAAGATGTATAG
TAGAGGAAGATATCGAAGATAGATAGATGGATAATTAAGTATTAAGTAGGAAATAGGATA
TAGAGATAATAAATAAAGAATTAAAGAGAAGAGGAAAGGTGATGAAAAGAATATAATGAG
AGATGGGGTATGAGTAGTAAATTTGGACGTAAGATGAGTAGTGATGAAATAAAGATATGA
AATAAGTGATAAGGAGGTAAAAACATGAGTGACAGAAGATAGTAAAGAGAAGAGCGAGGG
TAGAGAATATATTTGTAGAATAATAGAAAAAGAGATGAGTGATGAGCAAGTATCTGATTT
TATAATGATGAGAAGAAAATGGAGGGCATATATATATGGGTGTGGTTATGGGGGTTAAGA
GATAAAGGAGGGAGGATATAGGTTAAATAATTAATGTAATGA
GenBank Accession FR803658 [GenBank]
Graphic View Graphic view of gene At3g50850
Predicted Position of Insertion Chr3:18901738 - go to primer design
BLAST e Value 8e-37
Hit Clone Code (BAC ID) F18B3
Hit Gene Code At3g50850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Putative methyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764418 [GenBank] FR803657 [GenBank] FR803658 [GenBank]

Gene hit At1g22700

 
Sequence (A. th genome BLAST matches underlined)
>61-K012923-022-125-E08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCATGAGTCTGCATGCCTATCTTTGCATGGCACCTCACTACTACTTACCT
GCTTAAAGATTCATACTTTACTATACATGTATGGGATCCTCCCTATAGCGAGTCGTGATA
CTCATTACTCANNNNAANTGTNNATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTC
TAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTTACACGA
GAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCATATCATCTTCAGAT
TGGACTGAGATTATGCGAAAATATACCCTCGTGTACATCAAATCTGACAGCTTGAGCTAC
CAATCCGGCGTCAGGCCATGACCTTACATAATGTACTCAAAAGCTA
GenBank Accession FR803655 [GenBank]
Graphic View Graphic view of gene At1g22700
Predicted Position of Insertion Chr1:8029498 - go to primer design
BLAST e Value 6e-09
Hit Clone Code (BAC ID) T22J18
Hit Gene Code At1g22700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 31.08.2016 09:40