SimpleSearch - Line and FST details


Line specific information

 
Line ID 125F10
Vector Used pAC161
Line Availability only available from NASC (N411974)
Segregation Analysis 66:42:30
Confirmed for Hit At1g13040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g13040

 
Sequence (A. th genome BLAST matches underlined)
>78-K104602-0022-125-F10-8409
AGCCATTTCTTTGTCATCATCACCGTTGCCTCTTCTTTGTTTCAATGCGGCGACATCAGA
TCGACGACGACGGCTAGGTCTTGAGCTTAAGCTATGGGATCCACCCTATAGTGAGTCTAA
TCTCGCACAACCATATAGCCCAAACGGTCAGAGAACAAGAATCACCAAACTTCTATGGGA
TCCTCCCC
GenBank Accession FR803687 [GenBank]
Graphic View Graphic view of gene At1g13040
Predicted Position of Insertion Chr1:4447621 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) F3F19
Hit Gene Code At1g13040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR-like) superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764429 [GenBank] FR803686 [GenBank] FR803689 [GenBank]

Gene hit At1g22700

 
Sequence (A. th genome BLAST matches underlined)
>78-K012923-022-125-F10-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTCAGCATGTCTATCTTGTTATGGCACTTATCTTCTTCTTCCCT
GCTTAGAGGATCAAACTTCTACTATACATCCATGGGATCCTGCCTATTGTGAACTCTGTA
TACTGATCAGATTCCACATAATCTTCTTCTATCGTAAGAACAATTTACGAATCAAAATTC
TTGATTGGGGAAAAAACAGAGGAAACCCTATGGGATCCTCCCTATAGTGAGTCATATAAC
TCAATCCNACCNGTCTACTTTCACGATCAAATGGGGGCTTAGATGACACACTCGACCATC
GGAGCCTTGATATCACCATTTCCACAAACCAATCCCATGATTCAGACAGGGCTGAAATCA
TGCGAGAATATACACTCATATATCATAACTACTGACAGTTTGCGCTACCA
GenBank Accession FR803685 [GenBank]
Graphic View Graphic view of gene At1g22700
Predicted Position of Insertion Chr1:8029522 - go to primer design
BLAST e Value 6e-40
Hit Clone Code (BAC ID) T22J18
Hit Gene Code At1g22700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03