SimpleSearch - Line and FST details


Line specific information

 
Line ID 129D02
Vector Used pAC161
Line Availability only available from NASC (N412326)
Segregation Analysis 50:47:39
Confirmed for Hit At1g54130
Parent of DUPLO pair 2395
Parent of pair(s) none

Gene hit At1g54130

 
Sequence (A. th genome BLAST matches underlined)
>12-K012668-022-129-D02-8409
NTTTGATCCATGTAGATTTCCCGGACTGAAGCCTTTACATTGAATATTCCTGGTAACAGT
CCTCCGATGATGATTTCCGCGATCGGAACTTAAATGGTGGATCTGCGCTTCGTGTAGGAT
CTCACGGATGGTGCCTGGCTCAGTCCGACTCCTACGGGTGGATGCGATGATGACGATCCG
GACTATGTTCTTAGTTGATGCGCCGGTACCGGGCACCGTGGAACATGGTATGCGATGGAG
AGATAGGAGAACAATACGCCTTGGAATACCCCTTGTATTCTGCCGTTGACCTCACATACT
GGAACAGGCTTACGCAGAACTGGTCATGCTTCATTTCTCCGCTTACATCCAGTCTCTTGC
TTGAGGCCGGGATGCTATAGGAGCCTCCCTCTTGCGAATGGATTAACTGACTCCTCATGA
ATTTGCTCTCCGTGTCTGCAATTTGCGGTATGCGAGTACCGGGCTTGGTCGCCTATATTG
TTCATTAAAGGACCTGTTCTGTTAATGCGGTGTGTACTACTAACTATGGTGATCTTTGGC
ATGGCGAGTAAAATTACTGAGTTTATCCAAACGGAACCTTATTAGCTACTGTTATTTTTA
CATACATGGGAGGGCTCTTGGCTGGTGCCCCTAAATAAGGGTTATGAAATG
GenBank Accession AL764662 [GenBank]
Graphic View Graphic view of gene At1g54130
Predicted Position of Insertion Chr1:20211553 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) F15I1
Hit Gene Code At1g54130 [TAIR] [MIPS] [SIGnAL]
Gene Annotation RELA/SPOT homolog 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F23H14

 
Sequence (A. th genome BLAST matches underlined)
>12-K012958-022-129-D02-35St
TAATCTGACGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATA
AGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGC
CTTCGGTTTAAACTATCAGTGTTTGAGTCACCGTCGACAGCTTTTCCGCATCCGAGATTT
CAACCCGCAACTCATTCTCCAATGCGAGCAAGGCAACAAATGCGATGACGAGAGGTGAAC
AAGCGCCGATGTTTGTGCCCACGACTTCCCCACGAAAGAGAAGCCGCGGGCAAAGGTGTA
AACCAAACTCAACGATTCCTTCAAATTAGGTACGAAACACAGGCCCCGGAACTCATCAAC
GAGCGTAACATCGCCCGTGATTTAACTGACAACGATAGGTGGTAGGTAGTTCTGATGCGC
GAGCATGGAGCCTACGAACACTATCGGATCCTCCCTCACTCGAACCAGAAAACGTCCAAT
TAACCTCAAAATCATCAATCGATCCAACTAATCTACCGAAGTACTCGGCCTAAGAAGAAA
GAAGACGGACGAATCTCGAGCCAAAGCCCGTACAAGCGCGAAAAACCTTCGGGA
GenBank Accession AL764663 [GenBank]
Graphic View Graphic view of sequence AL764663 of line 129D02
Predicted Position of Insertion Chr2:3577 - go to primer design
BLAST e Value 1e-161
Hit Clone Code (BAC ID) F23H14
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23