SimpleSearch - Line and FST details


Line specific information

 
Line ID 130F06
Vector Used pAC161
Line Availability only available from NASC (N412450)
Segregation Analysis 100:100:100
Confirmed for Hit At5g10570
Parent of DUPLO pair 12837
Parent of pair(s) none

Gene hit At5g10570

 
Sequence (A. th genome BLAST matches underlined)
>46-K012667-022-130-F06-8409
TTGATCCATGTATNGATTTCCCGGACATGAAGTCCTTTACAATTGAATATATCCTAGTTG
AACGGCCACATACTGTGGCGAGCCTTCGTCTTCTGTGATCGTCTTGATCACATCCAATCA
GCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCATCTGCACCTTCAAGTGATTATAA
TTGTTTGAGTGATATCTAATGGGAATCAAATGGATTCCAGTCTCTGATGAGGGTGTGGGT
AACAGATGACATGCAATGGGATGAATTATTAAAATCACAAGACTTCTGACTACTGATGCA
CATATACCATAATAACATGATGTTTTGCCTTTAGCTTTTACCTTTACGGAGTTTCTGACC
ATAAATTCGTTTGTAATGAGGGTGCTTAAATGAGAGTTGCTTCCAAGATATTGATCGTCT
TCTTGCAACTTGTTAATCTTGTCCAAAAGCTCCTTCATGTAATCTATAGCATCTCCTATG
GGATCCTCCCTATAGGGAGGCGTTTTAGCTGAAANAAAGGGAATTAGGGCGACACGGAAA
TGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATCTATGAGGGCTATTGT
CTCATGAGCGGATACATATTTGAACGGTTTTAGGAAAATAACAAATGGGGGTTCCGCGCA
CATTTCCCCGAAAAGTGCCCCCTGACCTCTAAAAAACCCTTATCACCATGACTTTA
GenBank Accession BX890771 [GenBank]
Graphic View Graphic view of gene At5g10570
Predicted Position of Insertion Chr5:3342574 - go to primer design
BLAST e Value 2e-114
Hit Clone Code (BAC ID) F12B17
Hit Gene Code At5g10570 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23