SimpleSearch - Line and FST details


Line specific information

 
Line ID 131D04
Vector Used pAC161
Line Availability only available from NASC (N412520)
Segregation Analysis 137:122:94
Confirmed for Hit At3g18040
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g18040

 
Sequence (A. th genome BLAST matches underlined)
>28-K013050-022-131-D04-35St
AAACTGACGTAAGGGATGACGCTCAATCCACTATCCTTCGCAAGACCCTTCCTCTATATA
AGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGC
CTTCGGTTTAAACTATCAGTGCATATTTCATTTACACCGCATTGGAGTTATATTACTCTG
TGACAACCAACCTTATATACGTGATCTAAGATTGTATATTAAAAAGTAGTAAAACGCT
GenBank Accession CR356276 [GenBank]
Graphic View Graphic view of gene At3g18040
Predicted Position of Insertion Chr3:6175198 - go to primer design
BLAST e Value 1e-04
Hit Clone Code (BAC ID) MRC8
Hit Gene Code At3g18040 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation MAP kinase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g36910

 
Sequence (A. th genome BLAST matches underlined)
>28-K012721-022-131-D04-8409
TTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCATTG
CTGATAATTCCACTATAGATAGTGCCATATTGATCAGCGTATATGATGGTTGACTTATTG
TTTCTGGATTCATCGTGGGATTCACTGCTGGTGTGGCAACTATGGGATCCTCCCTATAGT
GAGTCCATNTACTGAAAATACCACATGCCTCCAGTTGCTATGACGACGTTGGAACAACTT
CTTTTTTCTCCACGATGCTCGTGGGGGGGGGGGGATCATTGGGAGCACCGCCGGCGGAAG
AATCATCATCGACGACGGCCTCTTCTTAATCGTGATGATGGTATTAGGAGCCACCTCCTT
TCTTCACCACTTTCTCCATAATAAGACGACTAACTGCTCAGCGAAGGACTACGAGGATGT
CGCCTATTACCACCCTTTCGAAAATCACCTTAGCCCTTCTGTGGTCTGATACTACTTCTT
CTATAGATAAGGAGGAGACCACCAGCGTGTGCTACACCATCATGACGAAGATTATTTTCT
TGTC
GenBank Accession FR803843 [GenBank]
Graphic View Graphic view of gene At2g36910
Predicted Position of Insertion Chr2:15502856 - go to primer design
BLAST e Value 2e-09
Hit Clone Code (BAC ID) T1J8
Hit Gene Code At2g36910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP binding cassette subfamily B1
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03