SimpleSearch - Line and FST details


Line specific information

 
Line ID 131E07
Vector Used pAC161
Line Availability only available from NASC (N412535)
Segregation Analysis 126:123:88
Confirmed for Hit At4g16330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g16330

 
Sequence (A. th genome BLAST matches underlined)
>53-K012721-022-131-E07-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGGACATGAATTGTAAAA
GAGCATGTCAGAATCTTACTCTCTATGGGATCCTCCCTATAGCAGAGTCGTATTACTGAC
TAATGCGAATCGGGCGCGGTTATCAGGCGCTACCTTTCATGATCCCTCCAAGACTGCAAG
GATAGCACCAGTTTCTCAACTCTCCCCACCGTCTTACAAGGAAGTTGTGTATGGTCAATA
TGTTTCTTCCTGGTACTCTAAAGGTCCTGAGGGTAAACGAAACCTCGATGCTCTTCTCTA
CTAAGTTTATGCTAATGAGTATGTGGACGCCAATTGCCACGGCTGAAAAGTGGTTTCACA
ATAGTGGCTGTAAAAACTCAAAAGACACAAACGATAAATAATAATAAACTGAATGAATCC
TATGGGATCCTCCCTATAGTGAGTCTTTTTACTC
GenBank Accession AL764826 [GenBank]
Graphic View Graphic view of gene At4g16330
Predicted Position of Insertion Chr4:9226543 - go to primer design
BLAST e Value 5e-170
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g16330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40